Isolation and Characterization of Microsatellite Markers in the Domestic Ferret (Mustela putorius furo)

Holly Ernest,Lisa Dalbeck,Tracy Drazenovich,Michelle Hawkins

doi:10.3390/ijms131216592

Holly Ernest, Lisa Dalbeck + Show 2 more

Open Access

https://doi.org/10.3390/ijms131216592

Copy DOI

Abstract

The domestic ferret (Mustela putorius furo) is an important model organism for the study of avian influenza and other diseases of humans and animals, as well as a popular pet animal. In order to evaluate genetic diversity and study disease relationships in ferrets, 22 nuclear microsatellite loci (17 dinucleotide and 5 tetranucleotide) were developed from ferret genomic libraries and organized into seven multiplex sets. Polymorphism was preliminarily assessed in one population in Australia and one in the USA, sampled with 25 individuals each. The loci displayed allelic diversity ranging from 1 to 5 alleles, and expected and observed heterozygosities ranging from 0.04 to 0.65 and 0.04 to 0.76, respectively. Additionally, the loci amplified products in 15 samples from the wild ancestor, European polecat (Mustela putorius) and domestic ferret-polecat hybrids. In polecat/hybrid samples, allelic diversity ranged from 3 to 8 alleles, and expected and observed heterozygosities ranged from 0.13 to 0.81 and 0.13 to 0.80 respectively. These markers will be useful for molecular assessments of genetic diversity and applications to evolution, ecology, and health in domestic ferrets and wild polecats.

Highlights

The domestic ferret (Mustela putorius furo) is used as a model organism for the study of disease states important to human health including avian influenza [1], immune response of enteric bacterial pathogens (Campylobacter jejuni) [2] and morbidity associated with obesity [3], to name a few
In order to provide molecular tools for genetic assessments at the genome, individual and population level, we identified 22 polymorphic nuclear microsatellite regions in the domestic ferret genome, developed and optimized multiplex groups of PCR primers to efficiently provide polymorphic genotypic data
A third set of samples contained European polecats (Mustela putorius, N = 6) and hybrids of Mustela putorius furo plus one of the following at 50% or more in reported pedigree: Mustela putorius (N = 4), Mustela eversmanni (N = 4), and Mustela siberica (N = 1)

Summary

Introduction

The domestic ferret (Mustela putorius furo) is used as a model organism for the study of disease states important to human health including avian influenza [1], immune response of enteric bacterial pathogens (Campylobacter jejuni) [2] and morbidity associated with obesity [3], to name a few. They are increasingly popular as house pets throughout many parts of the world. In order to provide molecular tools for genetic assessments at the genome, individual and population level, we identified 22 polymorphic nuclear microsatellite regions in the domestic ferret genome, developed and optimized multiplex groups of PCR primers to efficiently provide polymorphic genotypic data

Results and Discussion

F: TTTGGGTTCCACAGTAGGTG

Experimental Section

Conclusions