Abstract

The use of alternative promoters represents an important mechanism for the regulation of growth hormone receptor (GHR) gene expression. Two promoters have been isolated previously for the GHR gene: the P1 promoter that drives liver-specific expression, and the P2 promoter that drives ubiquitous expression. In the present study, we isolated a third GHR promoter termed P3. The P3 promoter was GC-rich and TATA-less. The P3 promoter was able to drive the expression of a luciferase reporter gene in cell lines Hep G2, PLC/PRF/5, and BHK-21. In vivo, the P3 promoter initiated transcription from two major sites in exon 1C of the GHR gene in many tissues. In the adult bovine liver, the P3-transcribed GHR mRNA represented only 10% of the total GHR mRNA pool. In non-hepatic tissues such as kidney, skeletal muscle, mammary gland, and uterus, P3-transcribed GHR mRNA represented 30-40% of the total GHR mRNA pool. Within the bovine GHR gene, the P3 promoter was located immediately downstream from the P2 promoter. In transfected cells, the P2 promoter served as an enhancer for the P3 promoter. Existence and co-regulation of two ubiquitous promoters may be a mechanism for achieving a high level of expression of the GHR gene in multiple tissues.

Highlights

  • The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) AF085281 (1C3 5Ј-untranslated regions (5Ј-UTRs))

  • Cloning of growth hormone receptor (GHR) cDNAs in various species has revealed that the GHR cDNA are heterogeneous in their 5Ј-untranslated regions (5Ј-UTRs) [18, 21, 23, 24] and that alternative 5Ј-UTRs are spliced onto a common splice site 11 bp upstream from the translation initiating codon AUG in exon 2

  • Cloning of the corresponding GHR genomic region (Fig. 5) and subsequent transfection analysis (Fig. 7) defined a new promoter (P3) that initiated the transcription of these 5Ј-UTRs from different sites in exon 1C (Fig. 5)

Read more

Summary

EXPERIMENTAL PROCEDURES

RNA Isolation—Various bovine tissues were collected at slaughter. Tissues were immediately frozen in liquid nitrogen and stored at Ϫ80 °C until used. Extraction of total RNA was carried out by using TrizolTM reagent (Life Technologies, Inc.) according to the manufactur-.

GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIGG ϩ
RESULTS
DISCUSSION

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.