Abstract

Iron-responsive element-binding proteins (IRE-BPs) are cytosolic proteins that bind to a conserved RNA stem-loop, termed the iron-responsive element (IRE), that is located in the 5'- or 3'-untranslated regions of mRNAs involved in iron metabolism. Binding of the IRE-BP to 5'-IREs represses translation, whereas binding to 3'-IREs stabilizes the mRNA. The previously identified IRE-BP (BP1) contains a 4Fe-4S cluster and has sequence homology to mitochondrial aconitase. The 4Fe-4S cluster is important for iron-dependent regulation: BP1 containing iron has low affinity for the IRE and contains aconitase activity, whereas BP1 lacking iron has high affinity for the IRE, but lacks aconitase activity. A second IRE-BP (BP2) has been identified in rat tissues and cells and exhibits many of the hallmarks of an IRE-BP, including binding to the IRE and functioning as a translational repressor of IRE-containing RNAs. BP1 and BP2 RNA binding activities are decreased in extracts from cells treated with iron, indicating that BP1 and BP2 are negatively regulated by iron. Although BP1 and BP2 share similar characteristics, they differ in two significant ways. Unlike BP1 levels, which do not change when RNA binding activity decreases in response to iron, BP2 decreases to undetectable levels in extracts from cells treated with iron; and unlike BP1, BP2 does not have aconitase activity. These data indicate that BP1 and BP2 are distinct proteins that have similar specificity for IRE binding and that function similarly in translation, but are regulated by iron via different mechanisms.

Highlights

  • RNA ferritin mRNA depends on the presence of a specific sequence stem-loop,termedtheiron-responsiveelement (IRE), called a n iron-responsive element (IRE) in its 5‘-untranslated that is located in the 5’- or 3’-untranslated regions of region [3, 4]

  • The net resuolft ferritin andTfR regulation changewhen RNA bindingactivitydecreasesinreby the iron-responsive element-binding protein (IRE-BP) is a decrease in intracellular free iron levels, sponse to iron, BP2 decreases to undetectable levels in thereby preventing irotnoxicity

  • T h o IRE-BPSAre Found in Rat Tissues and in RaHt epatoma

Read more

Summary

A Novel Iron-resEploenmseivnet-binding

The translation reactions (25 pl)contained 12.5 pCi of T r a ~ ~ ~ ~ S - l(IaCbNe lBiomedicals) and were carried out according to Promega protocols. The entire coding region of BP1 was amplified from the rat liver cDNA clone pSL8 [17] using one primer corresponding to the first 18 nucleotides of the coding region (ATGAAGAATCCAWGCG) and a second primer corresponding to the last 24 nucleotides of the coding region (CTACTGGGCCATCTTTCGGATCAT). Both primers contained a BamHI sitea t their 5"ends. The titer and the specificity of the chicken anti-rat BP1 antibodies were assayed by enzyme-linked immunosorbent assay and Western blotting

RESULTS
A Novel Iron-responsive Element-binding Protein
DISCUSSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call