Involvement of a cGMP-dependent Pathway in the Natriuretic Peptide-mediated Hormone-sensitive Lipase Phosphorylation in Human Adipocytes

Coralie Sengenès,Anne Bouloumié,Hans Hauner,Michel Berlan,Rudi Busse,Max Lafontan,Jean Galitzky

doi:10.1074/jbc.m303713200

Abstract

Our previous studies have demonstrated that natriuretic peptides (NPs), peptide hormones with natriuretic, diuretic, and vasodilating properties, exert a potent control on the lipolysis in human adipocytes via the activation of the type A guanylyl cyclase receptor (1, 2). In the current study we investigated the intracellular mechanisms involved in the NP-stimulated lipolytic effect in human preadipocytes and adipocytes. We demonstrate that the atrial NP (ANP)-induced lipolysis in human adipocytes was associated with an enhanced serine phosphorylation of the hormone-sensitive lipase (HSL). Both ANP-mediated lipolysis and HSL phosphorylation were inhibited in the presence of increasing concentrations of the guanylyl cyclase inhibitor LY-83583. ANP did not modulate the activity of the cAMP-dependent protein kinase (PKA). Moreover, H-89, a PKA inhibitor, did not affect the ANP-induced lipolysis. On primary cultures of human preadipocytes, the ANP-mediated lipolytic effect was dependent on the differentiation process. On differentiated human preadipocytes, ANP-mediated lipolysis, associated with an increased phosphorylation of HSL and of perilipin A, was strongly decreased by treatment with the inhibitor of the cGMP-dependent protein kinase I (cGKI), Rp-8-pCPT-cGMPS. Thus, ANP-induced lipolysis in human adipocytes is a cGMP-dependent pathway that induces the phosphorylation of HSL and perilipin A via the activation of cGKI. The present study shows that lipolysis in human adipocytes can be controlled by an independent cGKI-mediated signaling as well as by the classical cAMP/PKA pathway.

Highlights

Natriuretic peptides (NPs)1 are a family of polypeptide hormones (atrial NP (ANP), brain NP, and C-type NP) that regulate blood pressure, natriuresis, diuresis, together with renin and aldosterone release by direct effects on the kidney, the adrenal glands, and the systemic vasculature [3,4,5]
We demonstrate that the atrial NP (ANP)-induced lipolysis in human adipocytes was associated with an enhanced serine phosphorylation of the hormone-sensitive lipase (HSL)
We demonstrate that ANP-induced lipolysis is mediated by cGMP with the activation of cGMPdependent protein kinase I (cGKI), identified for the first time in human fat cells, which leads to the phosphorylation of HSL and perilipin A

Summary

GAGGACAGGACTCATCAAG AACCATATCTTTGTGCTGGC TATGACAACTCCCTCAAGAT

Human Mature Adipocyte Preparation—Isolated adipocytes were obtained according to the method of Rodbell [18] by collagenase digestion of adipose fragments in Krebs-Ringer bicarbonate buffer containing albumin (3.5 g/100 ml) and glucose (6 mmol/liter) at pH 7.4 and under gentle shaking at around 60 cycles/min at 37 °C. Lipolysis Measurement in Human Preadipocytes or Mature Adipocytes—Isolated mature adipocytes were brought to a suitable dilution (2000 –3000 cells/assay) in Krebs-Ringer bicarbonate buffer and incubated with pharmacological agents at the indicated concentrations for 90 min at 37 °C. For the RT, 1–2 ␮g of total RNA were incubated with 200 units of reverse transcriptase (SuperScript II; Invitrogen), dNTP (0.5 mmol/liter), hexamer (25 ng/liter), dithiothreitol (0.01 mol/liter), and reaction buffer in a final volume of 20 ␮l at 42 °C for 50 min and at 70 °C for 15 min. Western Blot Analysis—40 ␮g of cell lysate protein were separated by SDS-PAGE under denaturing conditions and transferred to nitrocellulose membranes, and Ponceau staining was performed to verify equal

TABLE II Primers for the human NP receptors

RESULTS

DISCUSSION