Abstract
Following nerve tissue damage, various events, such as inflammatory responses, microglial activation, endoplasmic reticulum stress, and apoptosis, can occur, which all lead to cell death, prevent axonal growth, and cause axonal circumvolution. So far, several researchers have tended to adopt strategies to reduce the harmful conditions associated with neurological disorders, and stem‑cell‑based therapy is one of those promising strategies. Epidermal neural crest stem cells (EPI‑NCSCs) are a type of stem cell that has widely been employed for the treatment of various neurological disorders. It has been suggested that these stem cells perform their supportive actions primarily through the release of different neurotrophic factors. Hence, in this study, the neuroprotective impacts of valproic acid (VPA) and crocin were evaluated on the mRNA expression levels of brain‑derived neurotrophic factor (BDNF) and glial‑cell‑derived neurotrophic factor (GDNF) in EPI‑NCSCs. In this research, we isolated EPI‑NCSCs from the hair follicles of the rat whisker pad. Then, the cells were treated with different concentrations of VPA and crocin for 72 h. Subsequently, an MTT assay was performed to define the suitable concentrations of drugs. Finally, real‑time PCR was performed to evaluate the mRNA expression levels of BDNF and GDNF in these stem cells. The results of the MTT assay showed that the treatment of EPI‑NCSCs with 1 mM VPA and 1.5 mM crocin, and the co‑treatment with 1 mM VPA and 500 μM crocin, led to the survival and proliferation of these stem cells. Moreover, the real‑time PCR results revealed that both VPA and crocin, both individually and in combination, can significantly increase the expression levels of BDNF and GDNF in EPI‑NCSCs. According to the findings of this study, both VPA and crocin, alone and in combination, are potential candidates for enhancing the capacity of EPI‑NCSCs to differentiate into neural lineages. Therefore, the co‑treatment of EPI‑NCSCs with these drugs can be employed for the treatment of various neurological disorders, such as spinal cord injury.
Highlights
Brain‐derived neurotrophic factor (BDNF) and gli‐ al‐cell‐derived neurotrophic factor (GDNF) are both related to the neurotrophic factor family, which play essential roles in neural development, cell survival, differentiation, and axonal growth, in both the cen‐ tral and peripheral nervous systems, during develop‐ment and in mature systems (Marsh and Blurton‐Jones, 2017)
Our study provided the first evidence for the po‐ tential use of valproic acid (VPA) and crocin as a co‐treatment in EPI‐NCSCs to regulate the mRNA expression levels of two neurotrophic factors, BDNF and GDNF
Overall, based on the wide range of studies that have assessed the impacts of various drugs on EPI‐NCSCs (Salehi et al, 2019), in the current investigation, we evaluated the synergistic effects of VPA and crocin on BDNF and GDNF expression levels in EPI‐NCSCs, in an in vitro context
Summary
Brain‐derived neurotrophic factor (BDNF) and gli‐ al‐cell‐derived neurotrophic factor (GDNF) are both related to the neurotrophic factor family, which play essential roles in neural development, cell survival, differentiation, and axonal growth, in both the cen‐ tral and peripheral nervous systems, during develop‐. Overall, based on the wide range of studies that have assessed the impacts of various drugs on EPI‐NCSCs (Salehi et al, 2019), in the current investigation, we evaluated the synergistic effects of VPA and crocin on BDNF and GDNF expression levels in EPI‐NCSCs, in an in vitro context. This therapeutic approach may subse‐ quently ameliorate conditions associated with neurode‐ generative disorders and may be employed in in vivo models of neurodegenerative disorders. Reverse primer (5ʹ→3ʹ) CAGAACAGAACAGAACAGAACAGG CCTCTGCGACCTTTCCCTCTG AACGCAGCTCAGTAACAGTCC groups were considered significant at p
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
