Intravenous Injection of Muse Cells as a Potential Therapeutic Approach for Epidermolysis Bullosa

Abstract

Multilineage-differentiating stress-enduring (Muse) cells, positive for stage-specific embryonic antigen-3, are endogenous pluripotent-like stem cells that reside in the bone marrow, peripheral blood, and connective tissue of organs and correspond to several percentages of cultured mesenchymal stem or stromal cells and fibroblasts (Kuroda et al., 2010Kuroda Y. Kitada M. Wakao S. Nishikawa K. Tanimura Y. Makinoshima H. et al.Unique multipotent cells in adult human mesenchymal cell populations.Proc Natl Acad Sci USA. 2010; 107: 8639-8643Crossref PubMed Scopus (341) Google Scholar). As shown by animal models of acute myocardial infarction, stroke, and chronic kidney disease, intravenously injected Muse cells specifically are home to damaged sites through the sphingosine-1-phosphate (produced by damaged cells)–Sphingosine-1-phosphate receptor 2 (expressed on Muse cells) axis and replace damaged and/or apoptotic cells by spontaneously differentiating into tissue-constituent cells to repair the organ (Uchida et al., 2017aUchida H. Niizuma K. Kushida Y. Wakao S. Tominaga T. Borlongan C.V. et al.Human Muse cells reconstruct neuronal circuitry in subacute lacunar stroke model.Stroke. 2017; 48: 428-435Crossref PubMed Scopus (46) Google Scholar, Uchida et al., 2017bUchida N. Kushida Y. Kitada M. Wakao S. Kumagai N. Kuroda Y. et al.Beneficial effects of systemically administered human Muse cells in adriamycin nephropathy.J Am Soc Nephrol. 2017; 28: 2946-2960Crossref PubMed Scopus (43) Google Scholar, Uchida et al., 2016Uchida H. Morita T. Niizuma K. Kushida Y. Kuroda Y. Wakao S. et al.Transplantation of unique subpopulation of fibroblasts, Muse cells, ameliorates experimental stroke possibly via robust neuronal differentiation.Stem Cells. 2016; 34: 160-173Crossref PubMed Scopus (63) Google Scholar, Yamada et al., 2018Yamada Y. Wakao S. Kushida Y. Minatoguchi S. Mikami A. Higashi K. et al.S1P-S1PR2 axis mediates homing of Muse cells into damaged heart for long-lasting tissue repair and functional recovery after acute myocardial infarction.Circ Res. 2018; 122: 1069-1083Crossref PubMed Scopus (33) Google Scholar). Clinical data support the reparative function of endogenous Muse cells in patients with acute myocardial infarction (Tanaka et al., 2018Tanaka T. Nishigaki K. Minatoguchi S. Nawa T. Yamada Y. Kanamori H. et al.Mobilized Muse cells after acute myocardial infarction predict cardiac function and remodeling in the chronic phase.Circ J. 2018; 82: 561-571Crossref PubMed Scopus (31) Google Scholar). Notably, allogenic Muse cells have been shown to survive in damaged host tissue as functional cells over 6 months without immunosuppressants, partly owing to the expression of HLA-G, relevant to immunomodulation in the placenta in Muse cells (Yamada et al., 2018Yamada Y. Wakao S. Kushida Y. Minatoguchi S. Mikami A. Higashi K. et al.S1P-S1PR2 axis mediates homing of Muse cells into damaged heart for long-lasting tissue repair and functional recovery after acute myocardial infarction.Circ Res. 2018; 122: 1069-1083Crossref PubMed Scopus (33) Google Scholar). Because of these properties, clinical trials have been conducted in patients with acute myocardial infarction and stroke on the basis of the intravenous injection of allogenic Muse cells (Dezawa, 2018Dezawa M. Clinical trials of muse cells.Adv Exp Med Biol. 2018; 1103: 305-307Crossref PubMed Scopus (14) Google Scholar). The potential of Muse cells to differentiate into keratinocytes, fibroblasts, and melanocytes in vitro has been reported (Kinoshita et al., 2015Kinoshita K. Kuno S. Ishimine H. Aoi N. Mineda K. Kato H. et al.Therapeutic potential of adipose-derived SSEA-3-positive Muse cells for treating diabetic skin ulcers.Stem Cells Transl Med. 2015; 4: 146-155Crossref PubMed Scopus (62) Google Scholar, Tsuchiyama et al., 2013Tsuchiyama K. Wakao S. Kuroda Y. Ogura F. Nojima M. Sawaya N. et al.Functional melanocytes are readily reprogrammable from multilineage-differentiating stress-enduring (muse) cells, distinct stem cells in human fibroblasts.J Invest Dermatol. 2013; 133: 2425-2435Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, Yamauchi et al., 2017Yamauchi T. Yamasaki K. Tsuchiyama K. Koike S. Aiba S. The potential of Muse cells for regenerative medicine of skin: procedures to reconstitute skin with Muse cell-derived keratinocytes, fibroblasts, and melanocytes.J Invest Dermatol. 2017; 137: 2639-2642Abstract Full Text Full Text PDF PubMed Scopus (16) Google Scholar). The therapeutic potential of subcutaneously injected Muse cells has been reported in diabetic skin ulcer mice (Kinoshita et al., 2015Kinoshita K. Kuno S. Ishimine H. Aoi N. Mineda K. Kato H. et al.Therapeutic potential of adipose-derived SSEA-3-positive Muse cells for treating diabetic skin ulcers.Stem Cells Transl Med. 2015; 4: 146-155Crossref PubMed Scopus (62) Google Scholar). However, there have been no investigations of whether intravenously injected Muse cells can benefit chronic recurrent skin injuries. Epidermolysis bullosa (EB) is a group of genodermatoses caused by mutations of genes encoding basement membrane zone proteins (Fine et al., 2014Fine J.D. Bruckner-Tuderman L. Eady R.A. Bauer E.A. Bauer J.W. Has C. et al.Inherited epidermolysis bullosa: updated recommendations on diagnosis and classification.J Am Acad Dermatol. 2014; 70: 1103-1126Abstract Full Text Full Text PDF PubMed Scopus (593) Google Scholar). Allogeneic cell therapies have been attempted owing to the systemic nature of EB (El-Darouti et al., 2016El-Darouti M. Fawzy M. Amin I. Abdel Hay R. Hegazy R. Gabr H. et al.Treatment of dystrophic epidermolysis bullosa with bone marrow non-hematopoeitic stem cells: a randomized controlled trial.Dermatol Ther. 2016; 29: 96-100Crossref PubMed Scopus (45) Google Scholar, Petrof et al., 2015Petrof G. Lwin S.M. Martinez-Queipo M. Abdul-Wahab A. Tso S. Mellerio J.E. et al.Potential of systemic allogeneic mesenchymal stromal cell therapy for children with recessive dystrophic epidermolysis bullosa.J Invest Dermatol. 2015; 135: 2319-2321Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, Rashidghamat et al., 2019Rashidghamat E. Kadiyirire T. Ayis S. Petrof G. Liu L. Pullabhatla V. et al.Phase I/II open-label trial of intravenous allogeneic mesenchymal stromal cell therapy in adults with recessive dystrophic epidermolysis bullosa.J Am Acad Dermatol. 2019; (accessed 30 March 2020)https://doi.org/10.1016/j.jaad.2019.11.038Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). We previously established type XVII collagen (Col17)-knockout (KO) mice that simulate junctional EB and recurrent skin injuries (Nishie et al., 2007Nishie W. Sawamura D. Goto M. Ito K. Shibaki A. McMillan J.R. et al.Humanization of autoantigen.Nat Med. 2007; 13: 378-383Crossref PubMed Scopus (221) Google Scholar). They are appropriate for evaluating treatments because few EB models are able to survive for a long period (Fujita et al., 2010Fujita Y. Abe R. Inokuma D. Sasaki M. Hoshina D. Natsuga K. et al.Bone marrow transplantation restores epidermal basement membrane protein expression and rescues epidermolysis bullosa model mice.Proc Natl Acad Sci USA. 2010; 107: 14345-14350Crossref PubMed Scopus (48) Google Scholar). This study investigates whether human Muse cells can bring benefits to EB mice. The epidermis of adult Col17-KO mice was mechanically detached, and 5.0 × 104 Nano-lantern–labeled human stage-specific embryonic antigen-3(+) Muse cells or stage-specific embryonic antigen-3(−) mesenchymal stem or stromal cells (non-Muse cells) were intravenously injected through the tail vein every 2 weeks for three times. In vivo imaging demonstrated stronger Nano-lantern signals at the injury site of the Muse-treated group than those of the non‒Muse- and vehicle-treated groups (Figure 1a and b). Ex vivo imaging of dissected injured skin confirmed the homing of injected Muse cells (Figure 1c). The bone marrow was the only tissue other than the skin that was positive for Nano-lantern (Figure 1d and Supplementary Figure S1a). We also intravenously injected 5.0 × 104 mCherry-labeled human Muse or non-Muse cells. In the Muse group, mCherry(+) cells that expressed keratin 14 and human desmoglein-3 were detected in the epidermis (Figure 1e). Such mCherry(+) cells were observed within hair follicles as keratin 15(+) and in the vessels as CD31(+). Notably, all the mice in the Muse group (n = 5) showed the linear deposition of human type VII COL (hCOL7) at the injury site where mCherry(+) Muse-derived cells were intensively integrated (Figure 1f). Similarly, four of the five mice in the Muse group showed the deposition of hCOL17 in association with mCherry(+) basal cells (Figure 1g). Some of this expression was observed in RT-PCR and digital PCR (Supplementary Figure S1b and c). In the non-Muse group, the integration of mCherry(+) cells was scarcely observed, and hCOL7 and hCOL17 were almost undetectable (Figure 1e–g). Next, the effectiveness of a clinical-grade Muse cell preparation, CL2020, developed by Life Science Institute (Tokyo, Japan) was evaluated as a potential treatment for EB model mice. Firstly, healthy C57BL/6J mice with a full-thickness wound were treated with the systemic administration of CL2020 cells. The CL2020-treated mice tended to show more rapid wound healing than the controls exhibited (Supplementary Figure S2). The immunofluorescence of the wound-healed skin tissues showed a deposition of hCOL7 and hCOL17 in the CL2020-treated group (Supplementary Figure S3). We also treated adult Col17-KO mice with CL2020. At 1 month, the wound-healed skin showed linear deposition of hCOL7 and hCOL17 (Figure 2a); a part of which showed genetic expression (Supplementary Figure S4a). Furthermore, the affected area expanded more slowly in the CL2020-treated group than in the vehicle-treated group (P < 0.05) at 4–6 months after treatment (Figure 2b and c). Immunofluorescence showed positive hCOL7 and hCOL17 at 6 months (Supplementary Figure S5). Of note, hair loss and the development of gray hair seemed to be suppressed in the CL2020-treated mice (Figure 2b), suggesting that CL2020 ameliorated the skin symptoms of Col17-KO EB mice. However, there was no statistical difference in the survival rate between the CL2020-treated group and the vehicle-treated group (P = 0.73, Supplementary Figure S4b). Our study demonstrates that intravenously injected human Muse cells preferentially engrafted into injured skin and spontaneously differentiated into skin components such as keratinocytes, hair follicle cells, vascular endothelial cells, and sebaceous gland cells. Notably, keratin 15 expression suggested the commitment of human Muse cells to hair follicle stem cell differentiation in mice. This might be consistent with the improvement of clinical manifestations in CL2020-treated Col17-KO mice after 4 months; differentiated hair follicle stem cells might have increased in months after the treatment, leading to gradual clinical improvement. In addition, the linear deposition of hCOL7 and hCOL17 was observed in the basement membrane zone adjacent to mCherry(+) basal cells in the Muse-treated mice, suggesting that the Muse cells differentiated into keratinocytes and functionally restored basement membrane zone proteins at the injury site. Similarly, the clinical-grade Muse product may have in certain settings the capability to produce COL17 and COL7. In light of the above, our study suggests that Muse cells and CL2020 may have the potential to deliver beneficial effects in severe EB. All animal procedures were conducted according to guidelines provided by the Hokkaido University Institutional Animal Care and Use Committee under approved protocols (approval #16-0021 and #19-0011). The dataset of the paper is available at the following URL: https://doi.org/10.17632/3tkzv5vg6n.1. Yasuyuki Fujita: http://orcid.org/0000-0001-7934-9261 Miho Komatsu: http://orcid.org/0000-0003-3601-5442 San Eun Lee: http://orcid.org/0000-0003-4720-9955 Yoshihiro Kushida: http://orcid.org/0000-0002-5840-5292 Chihiro Nakayama-Nishimura: http://orcid.org/0000-0003-0416-9199 Wakana Matsumura: http://orcid.org/0000-0001-7921-0139 Shota Takashima: http://orcid.org/0000-0001-8883-7347 Satoru Shinkuma: http://orcid.org/0000-0002-6429-1498 Toshifumi Nomura: http://orcid.org/0000-0002-9954-6446 Naoya Masutomi: http://orcid.org/0000-0002-8626-8264 Makoto Kawamura: http://orcid.org/0000-0001-6117-2736 Mari Dezawa: http://orcid.org/0000-0001-9978-6178 Hiroshi Shimizu: http://orcid.org/0000-0002-9930-1326 YF, NM, and HS are inventors of a patent on the use of Muse cells in the treatment of EB. YK and MD are parties to a codevelopment and coresearch agreement with Life Science Institute, Inc (LSII, Tokyo, Japan). NM is a former employee of LSII. MKa is an employee of LSII. MD has a patent for Muse cells and the isolation method thereof licensed to LSII. MD and HS received a joint research grant from LSII. HS received a medical adviser fee from LSII. The authors thank I.M. Leigh (Queen Mary University of London, Whitechapel, London, UK) for the gift of antibodies against human type VII collagen (LH7.2) and Chihaya Miura for her technical assistance. Life Science Institute, Inc (Tokyo, Japan) supported this work in part by providing funding and CL2020 products. Conceptualization: YF; Data Curation: YF, MKo, YK, WM, MD; Formal Analysis: YF, MKo, YK, TN, MD; Funding Acquisition: HS; Investigation: YF, MKo, SEL, YK, CNN, WM, ST, SS, MD; Methodology: YF, YK, SS, MD; Project Administration: YF, MD; Resources: YF, WM, ST, SS, TN, NM, MKa; Supervision: MD, HS; Validation: WM, TN, MD, HS; Visualization: YF, MKo, SEL, YK, MD; Writing - Original Draft Preparation: YF; Writing - Review and Editing: YF, MKo, SEL, YK, CNN, WM, ST, SS, TN, NM, MKa, MD, HS Human bone marrow–mesenchymal stem or stromal cells (MSCs) were purchased from Lonza (PT-2501, Basel, Switzerland). The cells were cultured in EMEM Alpha modification (Sigma-Aldrich, St. Louis, MO) with 10% fetal bovine serum (SH30910.03, Hyclone, Logan, UT), 1 ng/ml human fibroblast GF-2 (130-093-840, Miltenyi Biotec, Bergisch Gladbach, Germany), 2 mM GlutaMAX I (Thermo Fisher Scientific, Waltham, MA), and 0.1 mg/ml kanamycin sulfate (Thermo Fisher Scientific) at 37 °C in 95% air and 5% carbon dioxide. Cells from passages 6 through 8 were used for multilineage-differentiating stress-enduring (Muse) and non-Muse cell isolation. Nano-lantern and mCherry were introduced into human Muse and non-Muse cells as described in previous report (Yamada et al., 2018Yamada Y. Wakao S. Kushida Y. Minatoguchi S. Mikami A. Higashi K. et al.S1P-S1PR2 axis mediates homing of Muse cells into damaged heart for long-lasting tissue repair and functional recovery after acute myocardial infarction.Circ Res. 2018; 122: 1069-1083Crossref PubMed Scopus (62) Google Scholar). The Nano-lantern and/or pcDNA3 was provided by Takeharu Nagai (Osaka University, Suita, Japan) (Saito et al., 2012Saito K. Chang Y.F. Horikawa K. Hatsugai N. Higuchi Y. Hashida M. et al.Luminescent proteins for high-speed single-cell and whole-body imaging.Nat Commun. 2012; 3: 1262Crossref PubMed Scopus (206) Google Scholar). For lentivirus production, pMD2G, pCMV deltaR8.74, pWPXL-Nano-lantern, and pWPXL-mCherry were transfected into LentiX-293T packaging cells (Takara Bio, Shiga, Japan) using Lipofectamine 2000 (Thermo Fisher Scientific). After 3 days, the viral supernatant was collected, centrifuged, and filtered through a 0.45-μm filter. Human bone marrow–MSCs were introduced with either Nano-lantern lentivirus or mCherry lentivirus, and then stage-specific embryonic antigen-3(+) and stage-specific embryonic antigen-3-(–) cells were collected as Nano-lantern(+)– or mCherry(+)–Muse and mCherry(+)–non-Muse cells, respectively. For the collection of human Muse and non-Muse cells from the Nano-lantern‒ and mCherry‒labeled human bone marrow–MSCs, human bone marrow–MSCs were incubated with rat antistage-specific embryonic antigen-3 antibody (330302, 1:1,000; BioLegend, San Diego, CA), followed by incubation with allophycocyanin-conjugated anti-rat IgM (1:100; Jackson ImmunoResearch, West Grove, PA) for the Nano-lantern–Muse cells and by FITC-conjugated anti-rat IgM (1:100; Jackson ImmunoResearch) for the mCherry–Muse cells. The cells were then sorted by FACS (BD FACS Aria II cell sorter, Becton Dickinson, San Jose, CA). CL2020, a clinical-grade Muse cell product, is developed and provided by Life Science Institute (Tokyo, Japan). It is obtained from healthy human volunteers and contains MSC-derived cells expressing stage-specific embryonic antigen-3(+), CD105(+), and CD45(–). Human skin tissues were obtained from healthy volunteers under local anesthesia. This study was approved by the Ethics Committee of Hokkaido University Hospital (approval #014-0041). C57BL/6J mice were purchased from CLEA Japan (Tokyo, Japan). C57BL/6J background type XVII collagen (Col) (Col17)-knockout (KO) mice are described in a previous report (Nishie et al., 2007Nishie W. Sawamura D. Goto M. Ito K. Shibaki A. McMillan J.R. et al.Humanization of autoantigen.Nat Med. 2007; 13: 378-383Crossref PubMed Scopus (235) Google Scholar). The KO mice had been backcrossed onto the C57BL/6J strain for at least 6 generations. Unless otherwise stated, all the recipient mice were 3‒5 weeks old. All animal procedures were conducted according to guidelines provided by the Hokkaido University Institutional Animal Care and Use Committee under approved protocols (approval #16-0021 and #19-0011). The 5-μm cryosections embedded in optimal cutting temperature compound (Muto Pure Chemicals, Tokyo, Japan) with or without 4% paraformaldehyde fixation were cut and subjected to indirect immunofluorescence. After a 10-minute blocking using 10% goat sera, the samples were incubated for 30 minutes at 37 °C or overnight at 4 °C with primary antibodies. The following primary antibodies and dilutions were used: anti-human COL17 (NC16A-3, 1:100; BioLegend), anti-human COL7 (LH7.2, 1:10; a kind gift from Leigh I.M. for Figure 2 and Supplementary Figure S5 or LH7.2, 1:1,000; Sigma-Aldrich, for Figure 1 and Supplementary Figure S3), anti-cytokeratin 14 (ab9220, 1:100; Abcam, Cambridge, UK), anti-human desmoglein 3 (5H10, 1:100; Santa Cruz Biotechnology, Dallas, TX), anti-cytokeratin 15 (MA5-11344, 1:100; Thermo Fisher Scientific), anti-CD31 (sc1506, 1:100; Santa Cruz Biotechnology), and anti-mCherry (ab167453, 1:1,000; Abcam). The following secondary antibodies were used at 1:500 titers: AlexaFluor488-conjugated goat anti-mouse IgG (Life Technologies, Carlsbad, CA) and AlexaFluor594-conjugated donkey anti-rabbit IgG (Jackson ImmunoResearch, West Grove, PA). The nuclei were counterstained with DAPI solution at room temperature for 5 minutes. Fluorescence staining was detected using a confocal laser scanning fluorescence microscope (Fluoview FV1000, Olympus, Tokyo, Japan). Back hair of the Col17-KO mice (n = 3 for each group) with an infusion of Nano-lantern–labeled cells or vehicle (n = 3 for each group) were removed under anesthesia. Then, the mice were treated with an intravenous injection of 1 mg coelenterazine H in saline containing 10% ethanol (Fujifilm Wako Pure Chemical, Osaka, Japan). In vivo images for luminescence were obtained 15 minutes after coelenterazine H injection by IVIS Lumina LT (Perkin Elmer, Waltham, MA). Then, the animals were killed under anesthesia, and each organ was dissected out and soaked in 50 μg/ml coelenterazine H in saline containing 10% ethanol. Ex vivo imaging was performed within 10 minutes after soaking as well. Data were collected and processed by Living Image software (Perkin Elmer). Total RNAs from tissues and cells were extracted using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, and 500 ng of total RNA was used for cDNA synthesis in SuperScript IV reverse transcriptase (Thermo Fisher Scientific) with random hexamers. Then, PCR was performed on each cDNA sample with the AmpliTaq Gold 360 Master Mix (Thermo Fisher Scientific) on a thermal cycler (iCycler, Bio-Rad, Hercules, CA). The primers specific for protein sequences are summarized in Supplementary Table S1. The PCR protocol for these genes included 35 cycles of amplification (denaturing at 94 °C for 45 seconds, annealing at 60 °C for 45 seconds, elongating at 72 °C for 45 seconds). Aliquots from each amplification reaction were analyzed by electrophoresis in 1.5% acrylamide-Tris-borate gels. Gel images were acquired and processed by an image analyzer (BioDoc-It System, UVP, Upland, CA). In this study, the QX200 Droplet Digital PCR System (Bio-Rad) was used. In brief, 1 μl of TaqMan primer and/or probes and cDNA from 50 ng of total RNA were mixed with 10 μl of ddPCR Supermix for Probes (no dUTP, Bio-Rad). Droplets were generated using the QX200 Droplet Generator. A DG8 cartridge holder and a gasket with 70 μl of Droplet Generation Oil per well and 20 μl of PCR reaction mixture were used. From the DG8 cartridge, 40 μl of the generated droplets were transferred to a 96-well PCR plate (Eppendorf, Hamburg, Germany). The plate was then heat-sealed using a PX1 PCR plate sealer and a pierceable foil seal. PCR was performed using a C1000 Touch deep-well thermal cycler. Conditions of thermal cycles were as follows: initial denaturation at 95 °C for 10 minutes, 40 cycles of denaturation at 94 °C for 30 seconds, annealing and extension at 60 °C for 1 minute, followed by a final last incubation at 98 °C for 10 minutes, and storage at 4 °C (ramp rate 2 °C per second). After amplification, the ddPCR 96-well-plate was placed into a plate holder of the QX200 Droplet Reader. PCR-positive and PCR-negative droplets of each sample were analyzed, and the fluorescent signals of each droplet were counted and quantified. TaqMan Gene Expression Assays were as follows: human KRT5 (Hs00361182_g1), human KRT10 (Hs00166289_m1), human KRT14 (Hs00559328_m1), murine Krt5 (Mm00503549_m1), murine Krt10 (Mm03009921_m1), and murine Krt14 (Mm00516876_m1). The epidermis of Col17-KO mice that stimulate human junctional epidermolysis bullosa was detached manually under proper anesthesia. The back hair of the mouse was removed, and erosions of 10 × 10 mm were formed by rubbing the surface of the skin mechanically. The following treatment was started 2 hours after wound formation: 5.0 × 104 Nano-lantern–labeled or mCherry-labeled Muse cells in 200 μl Hanks’ Balanced Salt Solution (HBSS) (vehicle) were systemically infused through the tail vein three times every 2 weeks without the administration of an immunosuppressant. We adopted the infusion protocol according to the previous chronic liver fibrosis model because multiple infusion is considered better than a single injection in chronic, recurrent injuries like epidermolysis bullosa (Iseki et al., 2017Iseki M. Kushida Y. Wakao S. Akimoto T. Mizuma M. Motoi F. et al.Muse Cells, nontumorigenic pluripotent-like stem cells, have liver regeneration capacity through specific homing and cell replacement in a mouse model of liver fibrosis.Cell Transplant. 2017; 26: 821-840Crossref PubMed Scopus (46) Google Scholar). The mice were euthanized 1 week after the third infusion, and the skin samples were collected and used for further investigation. As controls, wounded Col17-KO mice treated with 5.0 × 104 Nano-lantern–labeled or mCherry-labeled non-Muse cells and those treated with vehicle were also prepared. The number of animals used for the Muse, non-Muse, and vehicle groups was five for each group. Within 1 hour before injection, a round full-thickness wound of 5 mm in diameter was made on the back of each C57BL/6J mouse aged 5–6 weeks under anesthesia. Approximately 3.0 × 104 or 3.0 × 105 cells of CL2020 in 200 μl HBSS were injected through the tail vein. As a control, 3.0 × 105 cells of MSCs and 200 μl HBSS were intravenously injected into different mice as controls. The wounds were photographed every day, the areas of the wounds were measured using Image J software, and the ratio compared with the initial ulcer size was calculated (Schneider et al., 2012Schneider C.A. Rasband W.S. Eliceiri K.W. NIH Image to ImageJ: 25 years of image analysis.Nat Methods. 2012; 9: 671-675Crossref PubMed Scopus (31977) Google Scholar). After 2 weeks of wound formation, the epithelialized tissues were collected for further investigations. Adult Col17-KO mice aged 3–5 weeks were treated with the intravenous injection of CL2020. First, the back hair of the mouse was removed and erosions of 10 × 10 mm were formed by rubbing the surface of the skin under anesthesia. Approximately 3.0 × 105 cells of CL2020 in 150 μl of HBSS were injected intravenously through the tail vein (n = 13). As a control, 150 μl of HBSS was intravenously injected into the Col17-KO mice (n = 10). After 4 weeks of treatment, back skin tissue was obtained under local anesthesia, and the injury was closed by epidermal suture. Survival was observed until 6 months after treatment. CL2020- and vehicle-treated adult Col17-KO mice were photographed and evaluated for clinical manifestation according to the previous report (Ujiie et al., 2014Ujiie H. Sasaoka T. Izumi K. Nishie W. Shinkuma S. Natsuga K. et al.Bullous pemphigoid autoantibodies directly induce blister formation without complement activation.J Immunol. 2014; 193: 4415-4428Crossref PubMed Scopus (69) Google Scholar). In brief, the body areas were divided into eight sections (snout, eyes, head and neck, ears, forelegs, trunk, hindlegs, and tail), and the affected skin areas such as erosion, scale, and erythema were measured by two independent researchers (YF and MKo). Finally, the affected body surface area (%) was calculated by collecting each affected skin area. Dunnett’s multiple comparison test for evaluating wound closure rates in the wounded C57BL/6J mice, unpaired Student’s t-test for the evaluation of body surface area in Col17-KO mice and in vivo and ex vivo imaging analyses, Kaplan–Meier analysis for survival curves, and Log-rank test for survival evaluation were performed using Excel 2016 (Microsoft Corporation, Redmond, WA), with the add-in software Statcel4 (OMS Publishing, Saitama, Japan). Results were expressed as mean ± SEM.Supplementary Figure S2The intravenous infusion of CL2020 into wounded C57BL/6J mice. (a) Representative images of the wound closure. The mice treated with CL2020 tended to show more rapid shrinkage of the full-thickness wounds by day 3 than those treated with MSCs or vehicles. (b) Time-course of wound closure rates. The CL2020-treated group (3.0 × 105 cells) tended to show more rapid wound closure than the controls did. Five mice for each group were used. ∗P < 0.05 to MSC-treated group. MSC, mesenchymal stem or stromal cell.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S3Wound-healed skin tissue was positive for hCOL7 and hCOL17 in the BMZ after the treatment of CL2020 infusion. hCOL17 was not detected in the vehicle-treated mice (3.0 × 105 cells), whereas two of the five mice with CL2020 (3.0 × 104 cells) showed the linear deposition of hCOL17. Bars = 100 μm. BMZ, basement membrane zone; COL, collagen; hCOL, human collagen.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S4Human CL2020 infusion into Col17-KO EB mice. (a) Representative RT-PCR analyses of the wound-healed skin tissue in CL2020-treated mice. Two (for human COL7A1) and one (for human COL17A1) of the 10 CL2020-treated mice show positivity. (b) Survival rates for the vehicle-treated (Control) Col17-KO EB mice and the CL2020-treated mice. There is no statistical difference between the groups (P = 0.73). COL, collagen; EB, epidermolysis bullosa; hCOL, human collagen; KO, knockout.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Figure S5Wound-healed skin tissue of CL2020-treated mice was examined 6 months after the single CL2020 infusion. hCOL7 and hCOL17 were detected in the CL2020-treated mice, whereas RT-PCR analysis did not prove the mRNA expression of these (data not shown). Bars = 100 μm. COL, collagen; hCOL, human collagen.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Supplementary Table 1The List of Primers Used in This StudyGenePrimerCOL7A1ForwardCCCAGTACCGCATCATTGTGReverseCACAGTGTAGCTAAGCCCAGCOL17A1ForwardCCACTTCCACAGCATATGGGReverseAGGAACTTGCAGTCCTTGTGCD31ForwardCCCAGCCCAGGATTTCTTATReverseACCGCAGGATCATTTGAGTTDSG3ForwardTTCCTGATCACATGTCGGGCReverseCACCAGTGAGTTTGAGGCACTCOL1A1ForwardTCTGCGACAACGGCAAGGTGReverseGACGCCGGTGGTTTCTTGGT18SrRNAForwardGCAATTATTCCCCATGAACGReverseGGCCTCACTAAACCATCCAAmouse GusbForwardCAGGGTTTCGAGCAGCAATGReverseACCCAGCCAATAAAGTCCCG Open table in a new tab