Abstract
Background Yersinia pestis, the pathogen of plague, has greatly influenced human history on a global scale. Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR), an element participating in immunity against phages' invasion, is composed of short repeated sequences separated by unique spacers and provides the basis of the spoligotyping technology. In the present research, three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis.Methodology/Principal FindingsUsing PCR amplification, sequencing and online data processing, a high degree of genetic diversity was revealed in all three CRISPR elements. The distribution of spacers and their arrays in Y. pestis strains is strongly region and focus-specific, allowing the construction of a hypothetic evolutionary model of Y. pestis. This model suggests transmission route of microtus strains that encircled Takla Makan Desert and ZhunGer Basin. Starting from Tadjikistan, one branch passed through the Kunlun Mountains, and moved to the Qinghai-Tibet Plateau. Another branch went north via the Pamirs Plateau, the Tianshan Mountains, the Altai Mountains and the Inner Mongolian Plateau. Other Y. pestis lineages might be originated from certain areas along those routes.Conclusions/significanceCRISPR can provide important information for genotyping and evolutionary research of bacteria, which will help to trace the source of outbreaks. The resulting data will make possible the development of very low cost and high-resolution assays for the systematic typing of any new isolate.
Highlights
Yersinia pestis, the causative agent of plague, is a Gram-negative bacterium that belongs to Enterobacteriaceae
Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) loci in the seven sequenced Y. pestis genomes Each of the seven sequenced Y. pestis genomes contains three
The DRs are conserved within these three loci with a sequence of 59TTTCTAAGCTGCCTGTGCGGCAGTGAAC-39, and there is a truncated DRs in the 59 end of each CRISPR locus with the sequences of 59- TGCCTGTGCGGCAGTGAAC -39, 59TAAGCTGCCTGTGCGGCAGTGAAC -39 and 59GCTGCCTGTGCGGCAGTGAAC -39 for YPa, YPb and YPc, respectively
Summary
The causative agent of plague, is a Gram-negative bacterium that belongs to Enterobacteriaceae. Four biovars (bv.), including antiqua, orientalis, medievalis and microtus, are defined by biochemical characteristics and the first three are significantly pathogenic for humans. Three waves of human plague pandemics have led to the death of millions of people [1] and resulted in major social changes. Y. pestis has been found in more than 200 species of wild rodents inhabiting in plague foci in all the continents except Australia and Antarctica [2,3]. Y. pestis is included in the selected list of the bioterrorism-related agents [4,5,6]. The pathogen of plague, has greatly influenced human history on a global scale. Three CRISPR loci were analyzed in 125 strains of Y. pestis from 26 natural plague foci of China, the former Soviet Union and Mongolia were analyzed, for validating CRISPR-based genotyping method and better understanding adaptive microevolution of Y. pestis
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
