Abstract
Castration-resistant prostate cancer (CRPC) is a progressed stage of prostate cancer, which requires better understanding of the mechanisms and remains an unmet clinical need. As a common oncogene, K-Ras is associated with malignant behavior in different types of tumors but its role in CRPC is unknown. The present study aims to find the mechanism of K-Ras in CRPC and whether it can be used as a crucial molecule for the treatment of CRPC. For this purpose, tissue samples from primary prostate cancer (PPC) and CRPC patients were analyzed by immunohistochemistry and the data showed that K-Ras was elevated in CRPC. More importantly, higher K-Ras expression was related to a shorter recurrence-free survival time in patients with CRPC. In addition, K-Ras promoted the invasion, migration, and drug resistance of CRPC cells by activation of PLCε/PKCε signaling pathway. Meanwhile, the inhibitor of K-RasG12C mutants was able to inhibit malignant behavior of CRPC cells in vitro and in vivo. Inhibitors of K-RasG12C mutants have entered clinical trials. Taken together, the study shows that K-Ras may activate PKCε through PLCε, resulting in the alterations of malignant behavior of CRPC. Inhibitor 9, an inhibitor of the K-RasG12C mutant, has a strong anti-tumor effect in CRPC, which potentially suggests that inhibitors of this nature may serve as a promising treatment for CRPC.
Highlights
Prostate cancer is one of the most common types of male urinary tumors and the fifth cause of cancer-related death in men [1,2,3,4], and its incidence in China is increasing annually [5, 6]
Tissue samples from 50 PPC patients and 41 CRPC patients were collected at the First Affiliated Hospital of Chongqing Medical University (Chongqing, China) between January 2010
The results showed that all CRPC cell lines had significantly higher IC50 values than the parental LNCaP cell line (Figure 2A)
Summary
Prostate cancer is one of the most common types of male urinary tumors and the fifth cause of cancer-related death in men [1,2,3,4], and its incidence in China is increasing annually [5, 6]. E expression reported in CRPC cells [30, 31] It is worth exploring whether PKCε activation is related to prostate cancer progression. For the knockdown of PLCε [GGTTCTC TCCTAGAAGCAACC, our previously study had verified [35]], PKCε (#1, CCCTTCAAACCACGCATTAAA; #2, CTGCATGTT CAGGCATATTAT; #3, ATATGCTGTGAAGGTCTTAAA) or and different types of cell lines in vitro and in vivo to explore the method of K-RasG12C mutation lentivirus was the same. The present study suggests that inhibiting K-Ras can significantly delay the malignant behavior of CRPC cells and that the combined therapy of inhibitor 9 and ADT with or without chemotherapy may supply a new treatment strategy for patients with refractory prostate cancer
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
