Abstract
The terminator elements of eukaryotic class III genes strongly contribute to overall transcription efficiency by allowing fast RNA polymerase III (pol III) recycling. Being constituted by a run of thymidine residues on the coding strand (a poly(dA) tract on the transcribed strand), pol III terminators are expected to form highly stable triple-helix complexes with oligothymine peptide nucleic acids (PNAs). We analyzed the effect of a T10 PNA on in vitro transcription of three yeast class III genes (coding for two different tRNAs and the U6 small nuclear RNA) having termination signals of at least ten T residues. At nanomolar concentrations, the PNA almost completely inhibited transcription of supercoiled, but not linearized, templates in a sequence-specific manner. The total RNA output of the first transcription cycle was not affected by PNA concentrations strongly inhibiting multiple round transcription. Thus, an impairment of pol III recycling fully accounts for the observed inhibition. As revealed by the size and the state (free or transcription complex-associated) of the RNAs produced in PNA-inhibited reactions, pol III is "roadblocked" by the DNA-PNA adduct before reaching the terminator region. On different templates, the distance between the active site and the leading edge of the arrested polymerase ranged from 10 to 20 base pairs. Given their ability to efficiently block pol III elongation, oligothymine PNAs lend themselves as potential cell growth inhibitors interfering with eukaryotic class III gene transcription.
Highlights
High throughput transcription of eukaryotic genes encoding small RNAs involved in protein synthesis is one of the main tasks of RNA polymerase III1 and its associated factors (TFIIIA, TFIIIC, and TFIIIB)
Targeting the complementary poly(dA) tract of the class III gene terminator with an oligothymine peptide nucleic acids (PNAs) resulted in the formation of a stable (PNA)2-DNA adduct acting as a sequence-specific roadblock for elongating polymerase III (pol III)
The first one is a dramatic reduction in overall transcription efficiency, due to the fact that pol III molecules get stuck during the first transcription cycle, with the consequent loss of pol III recycling
Summary
PNAs—The H-T10-D-Lys-NH2 PNA was synthesized manually, according to published procedures [12,13,14], on a (4-methylbenhydryl)amine resin (Novabiochem) in a 6-mol scale. The yeast tRNAIle(UAU) and tRNAPro(UGG) genes, identified as I{TAT}LR1 and P{TGG}FL, respectively, by the MIPS nomenclature found on the web, were polymerase chain reactionamplified and inserted into the pBlueScript KS(ϩ) vector as described previously [16]. The tRNAAsn(GUU) gene (referred to as N{GTT}CR at MIPS), with 65 bp of 5Ј- and 84 bp of 3Ј-flanking regions, was amplified from yeast genomic DNA using Deep Vent DNA polymerase (New England BioLabs) and the following oligonucleotide primers: Asn_gtt (forward), 5Ј-CATACTCGAAGGGTAGTTGG; Asn_gtt (reverse), 5ЈGATTTTTCCATTCGCCATGC; the resulting amplification product (235 bp) was sequence-verified and inserted into the SmaI site of the pBlueScript KS(ϩ) vector. Permanganate Probing—The pBlueScript-tDNAIle(TAT) plasmid (100 ng) was preincubated with the T10 PNA in 1 mM Tris/HCl (pH 7.8) at 37 °C for 45 min in a volume of 11 l, permanganate oxidation, piperidine cleavage, and cleaved DNA purification were performed as described [19]. Transcripts were quantified with the Multi-Analyst/PC software (BioRad) using phosphorimaging of dried gels obtained with a Personal Imager FX (Bio-Rad)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
