Abstract
The oncoprotein MDM2 associates with ribosomal proteins L5, L11, and L23. Both L11 and L23 have been shown to activate p53 by inhibiting MDM2-mediated p53 suppression. Here we have shown that L5 also activates p53. Overexpression of L5 stabilized ectopic p53 in H1299 cells and endogenous p53 in U2OS cells. Consequently, L5 enhanced p53 transcriptional activity and induced p53-dependent G1 cell cycle arrest. Furthermore, like L11 and L23, L5 also remarkably inhibited MDM2-mediated p53 ubiquitination. The interaction of L5 with MDM2 was also enhanced by treatment with a low dose of actinomycin D. Actinomycin D-induced p53 was inhibited by small interference RNA against L5. By reciprocal co-immunoprecipitation, we further showed that there were at least two MDM2-ribosomal protein complexes in cells: MDM2-L5-L11-L23 and p53-MDM2-L5-L11-L23. We propose that the MDM2-L5-L11-L23 complex functions to inhibit MDM2-mediated p53 ubiquitination and thus activates p53.
Highlights
Introduction of siRNA againstL5 into Human Cells Followed by Treatment with actinomycin D (Act D)—RNA interference-mediated ablation of endogenous L5 was performed essentially as previously described [7, 16]
We propose that the MDM2-L5-L11-L23 complex functions to inhibit MDM2-mediated p53 ubiquitination and activates p53
L5 Interacts with MDM2 in Cells and in Vitro—We previously identified an MDM2 complex that contains ribosomal proteins L5, L11, and L23 from cytoplasmic fractions of a stable HA-MDM2-expressing 293 cell line (293-HA-MDM2) using immunoaffinity chromatography followed by mass spectrometry [7]
Summary
Introduction of siRNA againstL5 into Human Cells Followed by Treatment with Act D—RNA interference-mediated ablation of endogenous L5 was performed essentially as previously described [7, 16]. The 21-nucleotide siRNA duplexes with a 3Ј dTdT overhang, corresponding to L5 mRNA (AAGGGAGCTGTGGATGGAGGC), or the scramble II RNA duplex (AAGCGCGCTTTGTAGGATTC) as a control were synthesized (Dhamacon). These siRNA duplexes (0.2 M) were introduced into U2OS cells using Oligofectamine (Invitrogen) following the manufacturer’s protocol. To determine the global protein synthesis after L5 siRNA treatment, U2OS cells were transfected with either L5 siRNA or scramble RNA as above. The cells were directly lysed, and equal amounts (10 g) of total protein were loaded on a 10% SDS-PAGE gel followed by silver staining. The cells were lysed, and equal amounts of total proteins were loaded onto a 10% SDS-PAGE gel. The gel was incubated in an Amplify solution (Amersham Biosciences) for 10 min, dried, and exposed to x-ray film
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
