Inactivation of the Mycobacterial Rhamnosyltransferase, Which Is Needed for the Formation of the Arabinogalactan-Peptidoglycan Linker, Leads to Irreversible Loss of Viability

Jonathan A Mills,Kelly Motichka,Markus Jucker,Henry P Wu,Brian C Uhlik,Richard J Stern,Michael S Scherman,Varalakshmi D Vissa,Fei Pan,Manikuntala Kundu,Yu Fang Ma,Michael Mcneil

doi:10.1074/jbc.m407782200

Abstract

Temperature-sensitive mutant 2-20/32 of Mycobacterium smegmatis mc(2)155 was isolated and genetically complemented with a Mycobacterium tuberculosis H37Rv DNA fragment that contained a single open reading frame. This open reading frame is designated Rv3265c in the M. tuberculosis H37Rv genome. Rv3265c shows homology to the Escherichia coli gene wbbL, which encodes a dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol, alpha-3-L-rhamnosyltransferase. In E. coli this enzyme is involved in O-antigen synthesis, but in mycobacteria it is required for the rhamnosyl-containing linker unit responsible for the attachment of the cell wall polymer mycolyl-arabinogalactan to the peptidoglycan. The M. tuberculosis wbbL homologue, encoded by Rv3265c, was shown to be capable of restoring an E. coli K12 strain containing an insertionally inactivated wbbL to O-antigen positive. Likewise, the E. coli wbbL gene allowed 2-20/32 to grow at higher non-permissive temperatures. The rhamnosyltransferase activity of M. tuberculosis WbbL was demonstrated in 2-20/32 as was the loss of this transferase activity in 2-20/32 at elevated temperatures. The wbbL of the temperature-sensitive mutant contained a single-base change that converted what was a proline in mc(2)155 to a serine residue. Exposure of 2-20/32 to higher non-permissive temperatures resulted in bacteria that could not be recovered at the lower permissive temperatures.

Highlights

Temperature-sensitive mutant 2-20/32 of Mycobacterium smegmatis mc2155 was isolated and genetically complemented with a Mycobacterium tuberculosis H37Rv DNA fragment that contained a single open reading frame
In E. coli this enzyme is involved in O-antigen synthesis, but in mycobacteria it is required for the rhamnosyl-containing linker unit responsible for the attachment of the cell wall polymer mycolyl-arabinogalactan to the peptidoglycan
Isolation and Complementation of TS Mutant 2-20/32— Forty-seven M. smegmatis mc2155 TS mutants were isolated in Rhamnosyltransferase in Mycobacteria

Summary

EXPERIMENTAL PROCEDURES

Isolation of TS Mutants—The strategy for the isolation and enrichment of bacterial TS mutants in a culture as outlined by A. After the second enrichment the surviving cells were washed free of the antibiotic, diluted, plated on Luria Bertani agar supplement with 1% Tween 80 (Sigma), and incubated at 30 °C. Plasmids recovered contained significantly smaller M. tuberculosis DNA fragments than the desired 30-kilobase inserts, they were still used to attempt to complement some of the TS mutants. These smaller plasmids were probably the result of the instability of the larger constructs in the transduced E. coli host. M. tuberculosis wbbL was amplified using primers CCGAGCTCCTGAAGTGACTGACGTCCTGCCGG and GAGGTACCTTATTCAGTGCCGCCCTTCTACC from pCB120 The former primer included a SacI site and a stop codon designed to be in-frame with the ␤-galactosidase followed by the wbbL GTG start. After 24 h at 42 °C an inoculum of 2-20/32 and 2-20/32 (pCB120) was transferred into fresh LB broth and incubated at 30 °C, and the A600 was monitored

RESULTS

28 This study This study Stratagene Novagen This study This study

DISCUSSION