Abstract
Ovarian cancer is the third leading cause of cancer-related deaths in India. Epigenetics mechanisms seemingly plays an important role in ovarian cancer. This paper highlights the crucial epigenetic changes that occur in POTEE that get hypomethylated in ovarian cancer. We utilized the POTEE paralog mRNA sequence to identify major motifs and also performed its enrichment analysis. We identified 6 motifs of varying lengths, out of which only three motifs, including CTTCCAGCAGATGTGGATCA, GGAACTGCC, and CGCCACATGCAGGC were most likely to be present in the nucleotide sequence of POTEE. By enrichment and occurrences identification analyses, we rectified the best match motif as CTTCCAGCAGATGT. Since there is no experimentally verified structure of POTEE paralog, thus, we predicted the POTEE structure using an automated workflow for template-based modeling using the power of a deep neural network. Additionally, to validate our predicted model we used AlphaFold predicted POTEE structure and observed that the residual stretch starting from 237-958 had a very high confidence per residue. Furthermore, POTEE predicted model stability was evaluated using replica exchange molecular dynamic simulation for 50 ns. Our network-based epigenetic analysis discerns only 10 highly significant, direct, and physical associators of POTEE. Our finding aims to provide new insights about the POTEE paralog.
Highlights
Ovarian cancer is a slow and a silent killer in females leading to deaths annually [1–3]
Three motifs namely (i) CTTCCAGCAGATGTGGATCA, (ii) GGAACTGCC, (iii) CGCCACATGCAGGC had the maximum likelihood to be present in the nucleotide sequence of POTEE as these hits were matching to various other motifs present in the repositories such as JASPAR 2020 [39]
With the aid of an exploratory modus operandi, we identified six main matching motifs that are present in the mRNA sequence of POTEE paralog, out of them, three motifs – (i) CTTCCAGCAGATGTGGATCA, (ii) GGAACTGCC, (iii) CGCCACATGCAGGC are most probable candidates to be in the nucleotide sequence of POTEE as these were matching to other motifs already known to be ubiquitous in established and validated repositories
Summary
Ovarian cancer is a slow and a silent killer in females leading to deaths annually [1–3]. Ovarian cancer that forms from the epithelial cells of the oviduct (fallopian tube) is very common in females. There are five types of ovarian cancer –growing from the epithelial cells (high grade/low grade serous), oviduct, endometrioid (endometrium), mucinous (cervical glands), and clear cell tumors (vaginal rests) [3, 4]. The World Health Organization (WHO) reports that ovarian cancer is detected in females in their 60s [5]. The disease is still an apex challenge for clinicians as its initial screening and diagnosis are not specific. There is a lack of effective biomarkers, and no person-centric treatment strategy is available. Generic information suggests that age, familial history, genetics, environmental factors are responsible for causing ovarian cancer [2]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
