Abstract
IKKepsilon has recently been identified as a breast cancer oncogene. Elevated levels of IKKepsilon are associated with cell survival and growth. Here, we show that IKKepsilon interacts with and phosphorylates estrogen receptor alpha (ERalpha) on serine 167 in vitro and in vivo. As a result, IKKepsilon induces ERalpha transactivation activity and enhances ERalpha binding to DNA. Cyclin D1, a major target of ERalpha, is transcriptionally up-regulated by IKKepsilon in a phospho-ERalpha-Ser-167-dependent manner. Further, overexpression of IKKepsilon induces tamoxifen resistance, whereas knockdown of IKKepsilon sensitizes cells to tamoxifen-induced cell death. These data suggest that ERalpha is a bona fide substrate of IKKepsilon and IKKepsilon plays an important role in tamoxifen resistance. Thus, IKKepsilon represents a critical therapeutic target in breast cancer.
Highlights
IKK⑀ Phosphorylates and Interacts with ER␣—Previous studies have shown that phosphorylation of ER␣ by serine/threonine protein kinases (e.g. Erk, casein kinase II, pp90rsk1, Akt, and IKK␣) induces tamoxifen resistance [9, 22,23,24,25,26]
Frequent alterations of IKK⑀ kinase in breast cancer [15, 16] prompted us to examine whether IKK⑀ regulates ER␣
In vivo [32P]orthophosphate IKK⑀ Up-regulates Cyclin D1 Expression Primarily through labeling was performed in MCF10A cells, which were trans- Phospho-ER␣-Ser-167—Because cyclin D1 (CCND1) is a major fected with either ER␣ or ER␣-S167A together with and with- target of ER␣ [27], we investigated whether cyclin D1 is regulated by IKK⑀, and, if this is the case, whether IKK⑀-regu- with IKK⑀/ER␣ or IKK⑀/ER␣-S167A
Summary
IKK⑀ Phosphorylates ER␣ and Induces Tamoxifen Resistance sites. Primers used for CCND1 were as follows: forward (Ϫ1039) previous report [15], expression of IKK⑀ has no correlation with (AACAAAACCAATTAGGAACCTT), reverse (Ϫ770) ER␣ status in breast cancer cell lines (Fig. 1A). To further demonstratethat ER␣-Ser-167 is phosphorylated by IKK⑀, we ectopically expressed IKK⑀ in MCF7 cells and immunoblotted and immunostained with anti-pER␣-Ser-167 antibody.
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
