Abstract
The aims of this study were to identify the mutations of FecX gene in the local goats and to analyze its polymorphism as well as its influence on the prolific nature of the local goats in West Lombok Regency, Indonesia. The study was conducted in the Immunobiology Laboratory of Mataram University, using DNA isolated from 100 blood samples of local female goats which have given birth of once to three times. The methods used were PCR-RFLP method and the PCR products were digested with HinfI restriction enzyme (G|ANTC) then analyzed visually based on DNA banding patterns on 2% agarose gels. The frequency of allele and genotype obtained, were then analyzed through a comparison with the secondary data of litter size obtained from the local goat keepers information. The results showed that the gene mutation of FecXG produced two alleles: "wild-type" (+) sized of 110 bp and 31 bp, and the mutant allele (G) of 141 bp with the allele frequency of 0,965 and 0,035 respectively. Combinations of alleles in the gene BMP15 produced two genotypes, namely (a) genotype ++ (110 bp/110 bp) with a frequency of 0.93, with the average litter size of 1.59 ± 0.319, and (b) genotype G + (141bp/110 bp), with a frequency of 0.07 and with the average litter size of 1.65 ± 0.202. The results of this study indicated that mutation occurred in BMP15 gene, i.e. FecXG gene, the gene responsible for the prolificacy of animals studied. Furthermore there was a correlation between polymorphism of FecXG gene and the prolific nature of the local goats, which was predicted to lead the divergence in litter size of each local goat genotype
Highlights
The aims of this study were to identify the mutations of FecX gene in the local goats and to analyze its polymorphism as well as its influence on the prolific nature of the local goats in West Lombok Regency, Indonesia
The results showed that the gene mutation of FecXG produced two alleles: "wild-type" (+) sized of 110 bp and 31 bp, and the mutant allele (G) of 141 bp with the allele frequency of 0,965 and 0,035 respectively
The results of this study indicated that mutation occurred in bone morphogenetic protein 15 (BMP15) gene, i.e. FecXG gene, the gene responsible for the prolificacy of animals studied
Summary
Penelitian ini dilakukan di Laboratorium Immunobiologi Universitas Mataram. Materi utama penelitian berupa DNA yang diisolasi dari sampel darah 100 ekor kambing lokal betina dewasa yang sudah melahirkan 2-3 kali dan dipelihara secara tradisional oleh peternak di Kabupaten Lombok Barat. Identifikasi mutasi gen FecX dilakukan menggunakan teknik PCR-RFLP (polymerase chain reactionreaction fragment length polymorphism), seperti yang dilakukan oleh Davis et al (2002), Chu et al (2007), dan Maskur et al (2010). PCR menggunakan Primer gen BMP-15 yang didesain berdasarkan informasi sekuen yang digunakan sebelumnya oleh Chu et al (2007), dengan sekuen Forward: 5' CACTGTCTTCTT GTTACTGTATTTCAATGAC-3', dan Reverse: 5’GATGCAATACTGCCTGCTTG 3'. Amplifikasi dilakukan mengikuti metode yang digunakan sebelumnya oleh Davis et al (2002) dan Chu et al (2007), sebanyak 35 siklus, meliputi siklus pertama adalah predenaturasi pada suhu 95o C selama 5 menit, diikuti denaturasi 95o C selama 45 detik, dilanjutkan dengan anelling 63oC selama 45 detik, dan ekstensi 72 oC selama 1 menit kemudian diakhiri satu siklus berikutnya pada ekstensi akhir 72 oC selama 10 menit (Chu et al, 2007). Selanjutnya, heterozigositas pengamatan (Ho), heterozigositas harapan (He) dan standar eror heterozigositas harapan serta nilai PIC dianalisa menurut Weir, (1996) dan perbedaan rataan litter size antara genotipe fragmen gen BMP-15 dianalisis dengan uji t (Mendenhall, 1987)
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have