Abstract
For identification of transgenic DNA of Arabidopsis plant material, the followed methods are transformation and growing of seeds after bleaching them for sterilization should be performed then using polymerase chain reaction (PCR) for amplification the gene before making gel electrophoresis to be ready for southern blot analysis, this method is possible because the length of the given primers, there are slightly modifications in the methods as ligating PCR technique developed for amplification of the unknown DNA after extracting it to determine its transgenicity. The methods were specific and reproducible for many different plants from transgenic and non-transgenic cell lines. Furthermore, the number of products of PCR result can be considered as a good estimation of transgenic DNA, during comparison to southern blot analysis, the results obtained by the PCR give information about DNA of Arabidopsis, applications of the approach to Arabidopsis plants after transformation with an Agrobacterium-mediated transformation will be described.
Highlights
There are 2 given primer sets which are DNA sequences for targeting Arabidopsis, each primer set consists of forward strand and reverse strand, primer set 1 sequence is: Forward: GGATCTTGAAGGAATTGAAG Revers: ATCGTTGCCTGCCAGTGAAAC And primer set 2 sequence is: Forward: TAGAAACCCCAACCCGTGAAATC Reverse: CAATGCTGATCAATTCCACAGTT By using The Basic Local Alignment Search Tool (BLAST) to find similarity between these primers to compare nucleotide sequences databases and adjust them on Arabidopsis taxid, the target sequence found in primer set 1 is for determining DNA extraction, it is similar to Arabidopsis thaliana ubiquitin-conjugating enzyme 10 (UBC10), mRNA which its sequence is GTTAAAAGTAGAGTCCACTAGTCAAAGAAAGTAAATAATCCACACG GTATTTATTGTAGACGTGAGCACA GAGAATAATTCGTATTCTTCGTCTTTCGTCCACCACCATCTCTATTTT CTTCCTTTCCCCTAAGTCTTGG TTCTTCTTCTCTCTAATACGAGAAGAAAAAGGCGAAAACCTCGCCAA
The transgenic Arabidopsis species overexpression can be detected using polymerase chain reaction (PCR) and Southern blot analysis for detection the transgenic DNA and using the primers which are target sequence of the DNA to determine the suitable cell lines, PCR is suitable for quantification DNA especially with plants containing high copy numbers
Transgenic plants contain more than one copy of transgene according to Southern blot analysis, so further experiments can be done in the future to detect the transgene related to the copy number so according to the results there is no match between using PCR and southern blot analysis
Summary
Arabidopsis is a plant from the family Cruciferae or Brassicaceae, it is one of the flowering plants related to white and black mustard this genus of plant is ideal for studying plant biology as the first complete sequence studied was the seeds of this plant for getting the complete genome [1]. Agrobacterium is a gram-negative bacteria used for gene transfer as it has the ability to transfer DNA between other plants, fungi and itself so it is a crucial tool for plant genetic engineering for improvement of the plant by transforma-. Tion [2], the gene is recombined with the plant e.g. Arabidopsis species and cloned using plant vector transformation in the presence of a suitable marker [3] which is antibiotic resistance for best selection of successfully transformed plant which is grown in the media with antibiotic after transformation [4] [5]
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have