Abstract
To study transcriptional regulation in the lower branching eukaryote Entamoeba histolytica, we have identified two sequence-specific DNA-binding proteins that recognize the upstream regulatory element URE4, an enhancer that regulates expression of the Gal/GalNAc lectin heavy subunit gene hgl5. A chromatographic purification of E. histolytica nuclear extracts by gel filtration, cation exchange, and sequence-specific DNA affinity chromatography led to a 700-fold increase in URE4 binding activity and the appearance of two dominant protein species with molecular masses of 28 and 18 kDa. These proteins, termed E. histolytica enhancer-binding proteins 1 and 2 (EhEBP1 and EhEBP2), were sequenced by tandem mass spectroscopy and their corresponding cDNA clones identified. Recombinant EhEBP1 and EhEBP2 were able to bind double-stranded oligonucleotides bearing the URE4 motif in a sequence-specific manner, and antibodies raised against EhEBP1 were able to interfere with the formation of URE4-protein complexes in crude nuclear extracts. Overexpression of EhEBP1 in E. histolytica trophozoites resulted in a 7-fold drop in promoter activity in transiently transfected reporter gene constructs when the URE4 motif was present, confirming its ability to specifically recognize the URE4 motif and suggesting that additional cofactors may be required for transcriptional activation by URE4. Further characterization and identification of binding partners for EhEBP1 and EhEBP2, the first proteins with demonstrated sequence-specific DNA binding activity to be identified in E. histolytica, should provide new insights into transcriptional regulation in this protozoan parasite.
Highlights
Control of gene expression in plants, animals, and fungi has been extensively studied, little is known about transcriptional regulation in the early branching eukaryotes
To study transcriptional regulation in the lower branching eukaryote Entamoeba histolytica, we have identified two sequence-specific DNA-binding proteins that recognize the upstream regulatory element URE4, an enhancer that regulates expression of the Gal/GalNAc lectin heavy subunit gene hgl5
Overexpression of EhEBP1 in E. histolytica trophozoites resulted in a 7-fold drop in promoter activity in transiently transfected reporter gene constructs when the URE4 motif was present, confirming its ability to recognize the URE4 motif and suggesting that additional cofactors may be required for transcriptional activation by URE4
Summary
Cultivation and Transfection of Amebae—E. histolytica trophozoites of strain HM-1:IMSS were grown at 37 °C in TYI medium containing penicillin (100 units/ml) and streptomycin (100 g/ml) [17]. After fractions containing proteins with native molecular masses of ϳ100 to 25 kDa (as calculated by column calibration using standards of known molecular mass) were allowed to flow into the cation exchange column, the gel filtration column was disconnected. The cation exchange column was washed with several column volumes of DNA-binding buffer (10 mM Tris-HCl (pH 7.9), 50 mM NaCl, 1 mM EDTA, 5% glycerol). Affinity chromatography was performed by incubating a single fraction of nuclear extract purified by gel filtration and cation exchange chromatography (containing 48 g of protein) with the URE4-complexed beads in DNA-binding buffer. Beads were washed twice with DNA-binding buffer before elution with this buffer plus 1 M NaCl. Electrophoretic Mobility Shift Assay—This assay was performed as described previously [20]. Sense strands of oligonucleotides used were TGAATTGTTATAAAAATGAATGGAAAAATGAAATGAATTA (URE4), TGAATTGTTATAATCTAGAATGGAAAAATGAAATGAATTA (mutant), and TGTTCCAAAAAGATATATTCTATTGAAAATAA-
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
