Identification of the Pore-forming Region of the Outer Chloroplast Envelope Protein OEP16

Thomas Steinkamp,Kerstin Hill,Silke C Hinnah,Richard Wagner,Thomas Röhl,Kai Pohlmeyer,Jürgen Soll

doi:10.1074/jbc.275.16.11758

Abstract

The chloroplast outer envelope protein OEP16 forms a cation-selective high conductance channel with permeability to amines and amino acids. The region of OEP16 directly involved in channel formation has been identified by electrophysiological analysis of a selection of reconstituted OEP16 mutants. Because analysis of these mutants depended on the use of recombinant protein, we evaluated the electrophysiological properties of OEP16 isolated directly from pea chloroplasts and of the recombinant protein produced in Escherichia coli. The results show that the basic properties like conductance, selectivity, and open probability of the channel formed by native pea OEP16 are comparable with the channel activity formed by the recombinant source of the protein. Following electrophysiological analysis of OEP16 mutants we found that point mutations and insertion of additional amino acid residues in the region of the putative helix 1 (Glu(73) to Val(91)) did not change the properties of the OEP16 channel. The only exception was a Cys(71)-->Ser mutation, which led to a loss of the CuCl(2) sensitivity of the channel. Analysis of N- and C-terminal deletion mutants of OEP16 and mutants containing defined shuffled domains indicated that the minimal continuous region of OEP16, which is able to form a channel in liposomes, lies in the first half of the protein between amino acid residues 21 and 93.

Highlights

The plastid organelle family conducts vital biosynthetic functions in every plant cell
The precipitated proteins of the chloroplast outer membrane were dissolved in 6 M urea, 20 mM Hepes/KOH buffer and applied to a strong anion-exchange matrix
Reconstitution of the Different OEP16 Derivatives—OEP16 purified from pea chloroplasts as well as wild type and mutant OEP16 isolated from E. coli were reconstituted using a modified dialysis technique as described in detail elsewhere [15]

Summary

EXPERIMENTAL PROCEDURES

Purification of OEP16 from Pea Chloroplasts—Outer envelope membranes were isolated from purified pea chloroplasts exactly as described previously [23]. OEP16-4␤-helix 3 and OPE16-helix 3/2/3—pETOEP16 – 4␤-helix 3 and pETOEP16-helix 3/2/3 were constructed by recombinant PCR as outlined in Fig. 1 using pETOEP16 as the template and T7 promotor or terminator primer in combination with helix 3/1 sense or helix 3/1 antisense primers as outlined in Fig. 1 (helix 3/1 sense primer 5ЈGCTGCAATTGCGACAGCTGCAGAATTCATAAATTACCTTACCGAGAGGATCCGTGGCACCAGGGACTGG3Ј and helix 3/1 antisense primer 5ЈGAATTCTGCACTGTCGCAATTGCAGCACCTGTAATGGCATCTTTACACATCTTCTTCAGAGATTTCTC3Ј). The products of both PCR reactions were purified by agarose gel electrophoresis, eluted from the gel, and used for a recombinant PCR reaction (Fig. 1). Windows-based analysis software (single channel investigation program (SCIP)) developed in our laboratory was used in combination with Origin 5.0 (Microcal Software Inc.)

RESULTS

DISCUSSION

Change in selectivity