Abstract

Brown rust is the main disease of wheat soft varieties in the Rostov region. The majority of wheat varieties (more than 87%) developed in the FSBSI “Agricultural Research Center “Donskoy” show resistance to this causative agent. In order to obtain a complete immunological characteristics of the developed varieties, there were carried out the researches to identify the resis­tance genes (Lr) in the early and adult stages of plant growing in cooperation with the Mycology and Phytopathology Laboratory of the FSBSI ARIZR. There were studied 37 varieties of winter soft wheat on the infectious fields of the south and northwest of Russia, as well as by the methods of a phytopathological test (to three isolates of the fungus with virulence to TcLr9, TcLr19, TcLr26 and the Zernograd pathogen population) and by the PCR analysis using 10 molecular markers Lr1, Lr3, Lr9, Lr10, Lr19, Lr20, Lr24, Lr26, Lr34 and Lr37. DNA was isolated by a micro-method according to K. Edwards, the PCR was carried out in a C-1000 amplifier (Bio Rad, US). The study established that there were no universal varieties among the studied ones which were resistant to all three clones and the Zergograd population. The varieties “Polina”, “Volnitsa” and “Zernogradka 11” showed resistance to the three clones, but in the phase of sprouting they show susceptibility to the pathogen population. According to the results of PCR analysis, the resistance genes Lr9, Lr19, Lr24, Lr26 were also not found in the varieties. 29 out of 37 studied varieties contained the adult resistance gene Lr34, and 20 varieties had the inefficient gene Lr3, which neither apart nor together could protect the plants from brown rust in the field. This indicates that the tolerant varieties carry additional non-identified Lr-genes. In a number of varieties there have been established 2 resistance genes. The variety “Kipchak” susceptible in the field contained the Lr1 gene, which lost its effectiveness. The differences in the damage degree of some varieties in the conditions of the Rostov region and St. Peters­burg indicate a difference in the North Caucasian and northwestern populations by virulence to the causative agent of brown rust.

Highlights

  • Brown rust is the main disease of wheat soft varieties in the Rostov region

  • In order to obtain a complete immunological characteristics of the developed varieties, there were carried out the researches to identify the resistance genes (Lr) in the early and adult stages of plant growing in cooperation with the Mycology and Phytopathology Laboratory of the FSBSI ARIZR

  • According to the results of PCR analysis, the resistance genes Lr9, Lr19, Lr24, Lr26 were not found in the varieties. 29 out of 37 studied varieties contained the adult resistance gene Lr34, and 20 varieties had the inefficient gene Lr3, which neither apart nor together could protect the plants from brown rust in the field

Read more

Summary

ЗАЩИТА РАСТЕНИЙ

Бурая ржавчина – основное заболевание сортов мягкой пшеницы на посевах в Ростовской области. Изучено 37 сортов озимой мягкой пшеницы на полевых инфекционных фонах юга и северо-запада России, в том числе методами фитопатологического теста (к трем изолятам гриба с вирулентностью к TcLr9, TcLr19, TcLr26 и зерноградской популяции патогена) и методом ПЦР-анализа с помощью 10 молекулярных маркеров: Lr1, Lr3, Lr9, Lr10, Lr19, Lr20, Lr24, Lr26, Lr34 и Lr37. В результате исследований установлено, что универсально устойчивых ко всем трем клонам и зерноградской популяции среди изученных сортов не выявлено. У 29 из 37 изученных сортов обнаружен ген взрослой устойчивости Lr34, а у 20 сортов – неэффективный ген Lr3, которые по отдельности и вместе не могут обеспечивать защиту от бурой ржавчины в полевых условиях. Различия в степени поражения отдельных сортов в условиях Ростовской области и Санкт-Петербурга свидетельствуют об отличии северокавказской и северо-западной популяций по вирулентности к возбудителю бурой ржавчины. Ключевые слова: озимая пшеница, бурая ржавчина, гены Lr, устойчивость, ПЦР-анализ

AND MODERN RESEARCH METHODS
Авирулентность к TcLr
AGGGGCTACTGACCAAGGCT TGCAGCTACAGCAGTATGTACACAAAA
Findings
Инокулянт и тип поражения

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.