Identification of species-specific molecular markers in different farm animals by PCR-RFLP analysis

Waqas Ahmad Khan

doi:10.19045/bspab.2018.70041

Abstract

Identification of species-specific molecular markers in different farm animals by PCR-RFLP analysis

Highlights

Introduction identification methods being currently usedMeat adulteration is a common practice for species origin detection in raw meat during preparation of meat products in many include hair histology, sensory analysis, countries and causes serious health, immune sera diffusion and electrophoresis in economic and religious concerns [1]
RFLP analysis Cytochrome b gene amplicons were digested by two restriction enzymes TasI and HinfI
The present study reveals the authenticity of species identification by the amplification of mitochondrial Cytochrome b gene followed by restriction fragment length polymorphism. 359 bp Cytochrome b gene region of each species was amplified by PCR

Summary

Introduction

Introduction identification methods being currently usedMeat adulteration is a common practice for species origin detection in raw meat during preparation of meat products in many include hair histology, sensory analysis, countries and causes serious health, immune sera diffusion and electrophoresis in economic and religious concerns [1]. The ager gel, fat tissues properties, glycogen level identification of meat adulteration in meat in muscle tissue, DNA hybridization and products is very important for the anatomical differences [3]. These implementation of labeling legislation and methods have some limitations in their use unfair competition prevention [2]. Different molecular approaches have been developed to identify different meat species These methods can reduce the shortcomings of conventional methods [5]. These molecular approaches include PCR, RAPD, AFLP, DNA hybridization and RFLP [6, 7, 8, 9]. Primers design and synthesis The common primers were used CYTb1 (5’CCATCCAACATCTCAGCATGATGAAA -3’) and CYTb2 (5’-GCCCCTC-AGAATGATATTTGTCCTCA-3’)

Results

Discussion

Conclusion