Year-end Sale % OFF 
Abstract
It has been shown by bioinformatic methods that regions of the Bombyx mori viral nuclear polyhedrosis genome encoded two small RNA--snc RNA-1 and snc RNA-2, which could perform a structural function in polyhedra crystals formation. The aim of this work was identification of the nucleotide sequence of small non-coding RNAs, predicted by bioinformatic methods in B. mori polyhedra. The following methods have been used: polymerase chain reaction, agarose gel electrophoresis, the cloning of PCR products, sequencing. There were first determined nucleotide sequences of snc RNA-1 and snc RNA-2 ofpolyhedrin mRNA complementary regions which are included in B. mori polyhedra. These RNAs have 100% identity with bioinformatic predicted sequences. These results confirmed our bioinformatic approach to the search for small RNAs encoded in B. mori nuclear polyhedrosis virus genome.
Highlights
Идентификация малых РНК в полиэдрах вируса ядерного полиэдроза Bombyx moriБиоинформативными методами показано, что в участках генома вируса ядерного полиэдроза Bombyx мori закодированы две малые РНК – snc RNA-1 и snc RNA-2, которые могут выполнять структурную функцию при формировании кристаллов полиэдров
Установлено, что нуклеотидные последовательности snc RNA-1 и snc RNA-2 комплементарны участкам мРНК полиэдрина, которые включаются в полиэдры B. mori
snc RNA-2 of polyhedrin mRNA complementary regions which are included in B. mori polyhedra
Summary
Биоинформативными методами показано, что в участках генома вируса ядерного полиэдроза Bombyx мori закодированы две малые РНК – snc RNA-1 и snc RNA-2, которые могут выполнять структурную функцию при формировании кристаллов полиэдров. Что полиэдры ВЯП B. mori содержат две малые РНК в виде рибонуклеопротеидных комплексов с молекулярной массой 17 и 21 кДа [7]. Биоинформативными методами нами показано, что в состав полиэдров могут включаться две малые РНК: snc RNA-1 длиной 54 нуклео тида (нт) GUCUUGUUCAUGUUCGACUAGGUG CUUCUUGCGCUUGGCGUUUUUGAUAAGAC и РНК длиной 64 нт snc RNA-2 ACGCAAAAAC UCUUUGCCGCUCCAGUUGACGAUUAACUU CAUGGUAUCGGGUUUCACACUGCGA [8]. Поэтому целью данной работы является установление нуклеотидной последовательности малых РНК из полиэдров ВЯП B. mori и доказательство их идентичности с ранее предсказанными последовательностями биоинформативными методами
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
