Abstract
Nrf2 regulates expression of genes encoding enzymes with antioxidant (e.g. heme oxygenase-1 (HO-1)) or xenobiotic detoxification (e.g. NAD(P)H:quinone oxidoreductase, glutathione S-transferase) functions via the stress- or antioxidant-response elements (StRE/ARE). Nrf2 heterodimerizes with small Maf proteins, but the role of such dimers in gene induction is controversial, and other partners may exist. By using the yeast two-hybrid assay, we identified activating transcription factor (ATF) 4 as a potential Nrf2-interacting protein. Association between Nrf2 and ATF4 in mammalian cells was confirmed by co-immunoprecipitation and mammalian two-hybrid assays. Furthermore, Nrf2.ATF4 dimers bound to an StRE sequence from the ho-1 gene. CdCl(2), a potent inducer of HO-1, increased expression of ATF4 in mouse hepatoma cells, and detectable induction of ATF4 protein preceded that of HO-1 (30 min versus 2 h). A dominant-negative mutant of ATF4 inhibited basal and CdCl(2)-stimulated expression of a StRE-dependent/luciferase fusion construct (pE1-luc) in hepatoma cells but only basal expression in mammary epithelial MCF-7 cells. A dominant mutant of Nrf2 was equally inhibitory in both cell types in the presence or absence of CdCl(2). These results indicate that ATF4 regulates basal and CdCl(2)-induced expression of the ho-1 gene in a cell-specific manner and possibly in a complex with Nrf2.
Highlights
Nrf 2 regulates expression of genes encoding enzymes with antioxidant (e.g. heme oxygenase-1 (HO-1)) or xenobiotic detoxification (e.g. NAD(P)H:quinone oxidoreductase, glutathione S-transferase) functions via the stress- or antioxidant-response elements (StRE/ ARE)
CNC-basic region/ leucine zipper (bZIP) proteins are distinguished from other bZIP subfamilies, including those composed of Jun, Fos, activating transcription factor (ATF)/CREB, or Maf factors, in that they contain a Cap’n’Collar (CNC) structural motif homologous to a region within the Drosophila homoeotic selector protein encoded by the cap’n’collar gene [9]. bZIP proteins function as obligate dimers; for example, individual Jun-Jun or Jun-Fos dimers are commonly and collectively referred to as activator protein-1 transcription factors
Identification of ATF4 as an Nrf 2-interacting Protein—To identify proteins that interact with Nrf 2, a cDNA fragment encoding the C-terminal portion of mouse Nrf 2 was amplified by PCR and cloned in-frame and downstream of the Gal4 DNA-binding domain (Gdbd)
Summary
Tissue culture media were from Life Technologies, Inc., and fetal bovine serum was obtained from Mediatech. The dominant mutant of Jun D (pCMV/JunDM) was constructed by cloning the 591-base pair BssHII/BssHII (blunt-ended) fragment of the mouse Jun D cDNA into the vector pCMV-Tag2B (Stratagene) This manipulation deletes amino acid residues 1–169 resulting in a transactivation domain-deficient mutant of Jun D similar to one described earlier [20]. DNA representing rat brain or liver cDNAs, cloned into the Gal activation domain vector pPC86, was transformed into MaV203/pDBLeu-Nrf 2 strain. The 5Ј end of the rat ATF4 cDNA was isolated by PCR amplification (5Ј-rapid amplification from cDNA ends) from a rat brain Marathon-Ready cDNA mixture (CLONTECH) according to the manufacturer’s recommendation using two different gene-specific primers ATF4-1 (5Ј-TAGGACTCAGGGCTCATACAGATGCCA-3Ј) and ATF4-2 (5Ј- TTGAAGTGCTTGGCCACCTCCAGATAG3Ј) and the adaptor primer provided in the kit Both amplification products were purified and cloned into the pT-Adv vector (CLONTECH Laboratories Inc). All antibodies were used at dilutions recommended by the respective suppliers
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
