Abstract
Abstract Mutations in the tafazzin (TAZ) gene on chromosome Xq28 are responsible for the Barth syndrome (BTHS) phenotype resulting in a loss of function in the protein tafazzin involved in the transacylation of cardiolipin, an essential mitochondrial phospholipid. TAZ gene was investigated in the proband in our study, who died of dilated cardiomyopathy at 8 months of age, and his family by sequencing to identify the genetic cause of BTHS. Molecular analysis revealed a novel mutation in exon 5 (c.520T>G) of the TAZ gene. This novel mutation c.520T>G, pW174G, was also found in female carriers (mother and grandmother of proband) in the family. Bioinformatic analysis was carried out to examine the effect of mutation in the gene and confirmed the deleterious effect of this single mutation to the protein structure. Protein modeling and 3-dimensional structure of TAZ protein demonstrated the significantly visible changes in mutated protein leading to BTHS phenotype. Prenatal diagnosis in a subsequent pregnancy showed a carrier female, and pregnancy was continued. Child is doing well at 1 year of age.
Highlights
Barth syndrome (BTHS; Online Mendelian Inheritance in Man [OMIM] accession no. 302060) is an X-linked disorder caused by a mutation in TAZ (G4.5 or TAFAZZIN) gene.[1]
Heart failure is the main cause of death in infancy, followed by sepsis due to neutropenia, which causes some variability in the clinical course of BTHS.[4]
We made a postmortem diagnosis of BTHS in an infant who died of dilated cardiomyopathy with left ventricular (LV) noncompaction, based on family history and characteristic findings, and analyzed TAZ gene in the proband and his family
Summary
Barth syndrome (BTHS; Online Mendelian Inheritance in Man [OMIM] accession no. 302060) is an X-linked disorder caused by a mutation in TAZ (G4.5 or TAFAZZIN) gene.[1]. At 8 months, his echocardiogram showed a dilated cardiomyopathy of noncompaction type, severe LV dysfunction (LVEF 1⁄4 10%), and dilated left atrium and left ventricle—all suggestive of severe congestive heart failure with peripheral circulatory collapse. He died a few days after acute deterioration at 8 months of age. In view of the clinical presentation with dilated and LV noncompaction type of cardiomyopathy, and neutropenia on a background family history highly suggestive of an X-linked disorder, a clinical diagnosis of BTHS was made and gene studies performed. Base pos. 421 CATGGGGACTGGGTGCATATCTTCCCAGAAGGGAAAGTGAACATGAGTTCNGAATTCCTG 480 Amino acid 141 HGDWVHIFPEGKVNMSSEFL 160
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callMore From: Journal of Inborn Errors of Metabolism and Screening
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
