Identification of a Mosaic Activating Mutation in GNA11 in Atypical Sturge-Weber Syndrome

Abstract

Sturge-Weber syndrome (SWS) (Online Mendelian Inheritance in Man #185300) is a capillary malformation condition (Bichsel and Bischoff, 2019Bichsel C. Bischoff J. A somatic missense mutation in GNAQ causes capillary malformation.Curr Opin Hematol. 2019; 26: 179-184Crossref PubMed Scopus (10) Google Scholar; Comi, 2015Comi A.M. Sturge-Weber syndrome.Handb Clin Neurol. 2015; 132: 157-168Crossref PubMed Scopus (37) Google Scholar). Affected regions include the skin (typically with facial cutaneous vascular malformations called port-wine birthmarks), brain (often resulting in seizures, intellectual disability, and recurrent stroke-like episodes), and eye (often causing glaucoma). We (Shirley et al., 2013Shirley M.D. Tang H. Gallione C.J. Baugher J.D. Frelin L.P. Cohen B. et al.Sturge-Weber syndrome and port-wine stains caused by somatic mutation in GNAQ.N Engl J Med. 2013; 368: 1971-1979Crossref PubMed Scopus (558) Google Scholar) and others (Frigerio et al., 2015Frigerio A. Wright K. Wooderchak-Donahue W. Tan O.T. Margraf R. Stevenson D.A. et al.Genetic variants associated with port-wine stains.PLoS One. 2015; 10e0133158Crossref PubMed Scopus (27) Google Scholar; Nakashima et al., 2014Nakashima M. Miyajima M. Sugano H. Iimura Y. Kato M. Tsurusaki Y. et al.The somatic GNAQ mutation c.548G>A (p.R183Q) is consistently found in Sturge-Weber syndrome.J Hum Genet. 2014; 59: 691-693Crossref PubMed Scopus (66) Google Scholar) reported that 90% of individuals with SWS or nonsyndromic port-wine birthmarks have a mosaic, activating mutation in GNAQ, encoding Gαq. The same mutation at other sites on the skin can also result in cutaneous vascular and soft tissue overgrowth and underlying malformations (Gao et al., 2017Gao L. Yin R. Wang H. Guo W. Song W. Nelson J.S. et al.Ultrastructural characterization of hyperactive endothelial cells, pericytes and fibroblasts in hypertrophic and nodular port-wine stain lesions.Br J Dermatol. 2017; 177: e105-e108Crossref PubMed Scopus (5) Google Scholar; Ma et al., 2018Ma G. Yu Z. Liu F. Wang L. Yu W. Zhu J. et al.Somatic GNAQ mutation in different structures of port-wine macrocheilia.Br J Dermatol. 2018; 179: 1109-1114Crossref PubMed Scopus (6) Google Scholar; Tan et al., 2016Tan W. Nadora D.M. Gao L. Wang G. Mihm Jr., M.C. Nelson J.S. The somatic GNAQ mutation (R183Q) is primarily located within the blood vessels of port wine stains.J Am Acad Dermatol. 2016; 74: 380-383Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). Identification of other noncanonical pathogenic mutations may elucidate further the pathophysiology of SWS and/or port-wine birthmarks and define genetic subtypes. Based on targeted next-generation sequencing, we identified five individuals with SWS and/or port-wine birthmarks who were negative for GNAQ R183Q mutations (Table 1). These studies were performed with Johns Hopkins Institutional Review Board approval. Written informed consent was obtained by the National Institutes of Health NeuroBioBank that provided samples. We set the lower threshold for calling mutations at 10 times the sequencing error rate for Q30 base quality scores, that is, a 1% mutant allele frequency. One case (SWS 3) had mutant allele frequencies of 0.58% and 0.22% in two independent affected brain samples. These values were below the 1% threshold for calling a mutation but significantly above background frequencies of other samples (range, 0.02–0.12%, n = 10, P < 0.00074, two-tailed t-test).Table 1Demographics and Results of Targeted GNAQ p.R183 Sequencing and WESCaseAgeSexRace1Ethnicity was C or U.SampleRegion (Source)2Brain samples were from right hemisphere (SWS 2) or bilateral (SWS 1, SWS 4, SWS 5).Status3Samples were from regions presumed to be Aff or Unaff.GNAQ AF4Targeted amplicon sequencing of GNAQ exon 4 was performed using forward primer 5′-GGGTATTCGATGATCCCTGTGGTGGG-3′ and reverse primer 5′-CCTTTCCGTAGACAGCTTTGGTGTGATG-3′.WESWES Candidates5WES was performed on eight samples using the Illumina HiSeq 2500 (Illumina, San Diego, CA) platform with Agilent SureSelect_V5 enrichment kit (Agilent, Santa Clara, CA) targeting 50,390,601 base pairs. Read length was 150 base pairs with total reads ranging from 35.9 to 40.4 million. The mean depth of coverage of targeted regions was ×69.SWS 115 y 89 dFCSWS1-BBrain (surg)Aff0.101NoneSWS 263 y 235 dMCSWS2-BBrain (PM)Aff0.062NoneSWS2-BPCBrain (PM)AffND——SWS2-SASkin (PM)Aff0.023GNA11 p.R183CSWS2-SA2Skin (PM)AffND——SWS2-SUASkin (PM)UnaffND4NoneSWS 32 y 6 moMUSWS3-BABrain (surg)Aff0.58——SWS3-B1Brain (surg)Aff0.225GNAQ p.R183QSWS3-B2Brain (surg)AffND——SWS 419 y 352 dMCSWS4-B1Brain (PM)Aff0.056NoneSWS4-B2Brain (PM)Aff0.12——SWS 55 y 12 dFCSWS5-BUBrain (PM)Unaff0.057NoneSWS5-BABrain (PM)Aff0.078GPRC6A6We identified a candidate gene mutation in case SWS 5, which had no evidence for mosaic mutations in GNAQ or GNA11. Utilizing DNA from affected brain tissue, we identified a mosaic mutation in GPRC6A. DNA from affected brain tissue had a mosaic predicted nonsense mutation (63 C residues, 4 A residues; 6.0% mutant AF). The GPRC6A G-protein coupled receptor senses high concentrations of extracellular calcium (and possibly amino acids and/or osteocalcin) and couples to Gαq (Pi et al., 2005). However, germline loss of function variants are extremely common (e.g., 6% population allele frequency for SNP rs550458778, and 39 loss of function variant alleles listed in the ExAC database [gnomeAD browser, 2019]). We therefore conclude that, although the mutation we observed appears somatic rather than germline, it is not pathogenic.Abbreviations: AF, allele frequency; Aff, affected; C, Caucasian; ExAC, Exome Aggregation Consortium; F, female; M, male; ND, not determined; PM, postmortem; SNP, single nucleotide polymorphism; Surg, surgical specimen; SWS, Sturge-Weber syndrome; U, unknown; Unaff, unaffected; WES, whole exome sequencing.1 Ethnicity was C or U.2 Brain samples were from right hemisphere (SWS 2) or bilateral (SWS 1, SWS 4, SWS 5).3 Samples were from regions presumed to be Aff or Unaff.4 Targeted amplicon sequencing of GNAQ exon 4 was performed using forward primer 5′-GGGTATTCGATGATCCCTGTGGTGGG-3′ and reverse primer 5′-CCTTTCCGTAGACAGCTTTGGTGTGATG-3′.5 WES was performed on eight samples using the Illumina HiSeq 2500 (Illumina, San Diego, CA) platform with Agilent SureSelect_V5 enrichment kit (Agilent, Santa Clara, CA) targeting 50,390,601 base pairs. Read length was 150 base pairs with total reads ranging from 35.9 to 40.4 million. The mean depth of coverage of targeted regions was ×69.6 We identified a candidate gene mutation in case SWS 5, which had no evidence for mosaic mutations in GNAQ or GNA11. Utilizing DNA from affected brain tissue, we identified a mosaic mutation in GPRC6A. DNA from affected brain tissue had a mosaic predicted nonsense mutation (63 C residues, 4 A residues; 6.0% mutant AF). The GPRC6A G-protein coupled receptor senses high concentrations of extracellular calcium (and possibly amino acids and/or osteocalcin) and couples to Gαq (Pi et al., 2005Pi M. Faber P. Ekema G. Jackson P.D. Ting A. Wang N. et al.Identification of a novel extracellular cation-sensing G-protein-coupled receptor.J Biol Chem. 2005; 280: 40201-40209Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar). However, germline loss of function variants are extremely common (e.g., 6% population allele frequency for SNP rs550458778, and 39 loss of function variant alleles listed in the ExAC database [gnomAD browser., 2019gnomAD browser. GPRC6A: G protein-coupled receptor class c group 6 member A, https://gnomad.broadinstitute.org/gene/ENSG00000173612?dataset=gnomad_r2_1; 2019 (accessed 26 August 2020).Google Scholar]). We therefore conclude that, although the mutation we observed appears somatic rather than germline, it is not pathogenic. Open table in a new tab Abbreviations: AF, allele frequency; Aff, affected; C, Caucasian; ExAC, Exome Aggregation Consortium; F, female; M, male; ND, not determined; PM, postmortem; SNP, single nucleotide polymorphism; Surg, surgical specimen; SWS, Sturge-Weber syndrome; U, unknown; Unaff, unaffected; WES, whole exome sequencing. We next performed whole exome sequencing and somatic variant calling to identify candidate causal mutations (Table 1). Case SWS 3 had 20 reads covering the GNAQ p.R183Q locus with 18 reference C reads, one T (5%) predicted to produce the R183Q mutation, and one A (5%) predicted to be synonymous. Targeted amplicon sequencing of exon 4 of GNAQ validated a T minor allele frequency (MAF) of 0.27% (22 of 8,030 reads) in SWS 3 and revealed a 0.1% (9 of 8,028) MAF in a control (NA12878). We conclude that the mutant allele frequency was less than the conservative threshold of 1% or greater variant nucleotides, but this low-level mosaic variation was nonetheless pathogenic. We suggest that, in an appropriate clinical or research setting, a lower threshold of ≥0.25% for calling a mutation may be justified, particularly when supported by large read depth by targeted amplicon sequencing as reported here. Our results are consistent with those of Uchiyama et al., 2016Uchiyama Y. Nakashima M. Watanabe S. Miyajima M. Taguri M. Miyatake S. et al.Ultra-sensitive droplet digital PCR for detecting a low-prevalence somatic GNAQ mutation in Sturge-Weber syndrome.Sci Rep. 2016; 6 ([published correction appears in Sci Rep 2017;7:39897]): 22985Crossref PubMed Scopus (37) Google Scholar, who suggested a minimum MAF threshold of 1% by next-generation sequencing, 0.25% using droplet digital PCR, and 0.1% using peptide nucleic acid combined with droplet digital PCR. Case SWS 2, a 63-year-old male, had negligible levels of GNAQ p.R183Q by targeted sequencing (0.02% and 0.06% in DNA from two separate brain samples) or by exome sequencing (22 C reads, zero alternate alleles). However, we identified a 6.1% mutant allele frequency of GNA11 p.R183Q mutation (93 C residues, 6 T residues) by whole exome sequencing, a finding validated by targeted next-generation sequencing in three separate affected tissue samples (MAFs in three brain regions were 0.7%, 1.9%, and 1.9%; MAF was 5.9% in affected skin and 0.06% in unaffected skin and 0.12% in control individual NA12878) (Table 2). The human GNA11 gene encodes Gα11 (NP_002058.2, 359 amino acids) that shares 90% amino acid identity with Gαq (NP_002063.2; also 359 amino acids). Germline mutations in GNA11 can cause hypocalciuric hypercalcemia type II (Online Mendelian Inheritance in Man #145981) and hypocalcemia dominant 2 (Online Mendelian Inheritance in Man #615361). Couto et al., 2017Couto J.A. Ayturk U.M. Konczyk D.J. Goss J.A. Huang A.Y. Hann S. et al.A somatic GNA11 mutation is associated with extremity capillary malformation and overgrowth.Angiogenesis. 2017; 20: 303-306Crossref PubMed Scopus (68) Google Scholar reported a mosaic, activating missense mutation in GNA11 (c.547C >T; p.Arg183Cys) in three patients with a diffuse capillary malformation of an extremity, whereas Thomas et al., 2016Thomas A.C. Zeng Z. Rivière J.B. O’Shaughnessy R. Al-Olabi L. St-Onge J. et al.Mosaic activating mutations in GNA11 and GNAQ are associated with phakomatosis pigmentovascularis and extensive dermal melanocytosis.J Invest Dermatol. 2016; 136: 770-778Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar identified GNA11 p.R183C or p.R183S in four patients with phakomatosis pigmentovascularis, including sites of vascular and pigmentary skin lesions. Associated pigmentary lesions in phakomatosis pigmentovascularis include melanocytic nevi; café au lait macules; dermal melanocytosis; and epidermal nevi and vascular lesions, including capillary and venous malformations and nevus anemicus (Fernández-Guarino et al., 2008Fernández-Guarino M. Boixeda P. de Las Heras E. Aboin S. García-Millán C. Olasolo P.J. Phakomatosis pigmentovascularis: clinical findings in 15 patients and review of the literature.J Am Acad Dermatol. 2008; 58: 88-93Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). GNA11-activating mutations have also been reported in uveal melanoma and blue nevi (Van Raamsdonk et al., 2010Van Raamsdonk C.D. Griewank K.G. Crosby M.B. Garrido M.C. Vemula S. Wiesner T. et al.Mutations in GNA11 in uveal melanoma.N Engl J Med. 2010; 363: 2191-2199Crossref PubMed Scopus (983) Google Scholar). Subject SWS 2 was diagnosed with meningeal angiomatosis with clinical suspicion of SWS on postmortem pathology; however, there were atypical features both clinically and pathologically. He had extensive port-wine involvement of the face and body on his right side, but no history of seizures, hemiparesis, or neurologic deficits before his acute hypertensive event; left thalamic and right subarachnoid bleeds; and infarct. Postmortem macroscopic neuropathologic evaluation revealed thickened, vascular congested leptomeninges, with what appeared to be an underdeveloped vascularity. Microscopic evaluation demonstrated dilated venules, degenerated arterial walls with thickening and myxoid substance, calcification, and evidence of macrophage accumulation (Figure 1). Additional patients exhibiting pathologic GNA11 mutations and features that overlap with SWS are needed to determine whether they all display a milder neurologic phenotype and later neurologic onset with hemorrhage than the typical patient with SWS and a R183Q somatic mutation in GNAQ.Table 2Targeted Sequencing Data for GNA11SampleRegionNucleotide CallAF1Mutant AF (percentage of T of total). Targeted amplicon sequencing of GNA11 exon 4 was performed using forward primer 5′- GTGCTGTGTCCCTGTCCTG -3′ and reverse primer 5′- GGCAAATGAGCCTCTCAGTG -3′.CATGSWS 2Brain7,9904610.07SWS 2Brain7,813915131.9SWS 2Brain7,831715711.9SWS 2Skin (affected)7,471646945.9SWS 2Skin (unaffected)8,0117500.06NA12878Blood7,98541010.12Abbreviations: AF, allele frequency; SWS, Sturge-Weber syndrome.1 Mutant AF (percentage of T of total). Targeted amplicon sequencing of GNA11 exon 4 was performed using forward primer 5′- GTGCTGTGTCCCTGTCCTG -3′ and reverse primer 5′- GGCAAATGAGCCTCTCAGTG -3′. Open table in a new tab Abbreviations: AF, allele frequency; SWS, Sturge-Weber syndrome. Data from this study are available upon request to JP. Jeremy Thorpe: http://orcid.org/0000-0002-6700-1513 Laurence P. Frelin: http://orcid.org/0000-0002-0514-5722 Meghan McCann: http://orcid.org/0000-0003-2081-4645 Carlos A. Pardo: http://orcid.org/0000-0002-4128-5335 Bernard A. Cohen: http://orcid.org/0000-0001-5213-6936 Anne M. Comi: http://orcid.org/0000-0001-7915-6881 Jonathan Pevsner: http://orcid.org/0000-0002-6328-0842 The authors state no conflicts of interest. We thank the individuals with Sturge-Weber syndrome and their families for participating in this study. We are grateful to the National Institutes of Health (NIH) NeuroBioBank for providing us the samples. We thank Macrogen Clinical Laboratories for kindly donating resources (to JP) to perform whole exome sequencing. We thank N. Varg for helpful discussions. AMC was supported by funding from the Celebrate Hope Foundation and the Faneca 66 Foundation . JP was supported by NIH grants U01 MH106884 and U54 HD079123 and by the Sturge-Weber Foundation . This work was supported by grants from the NIH (Lawton, Comi, and Marchuk) (grant number U54NS065705 ). The Brain Vascular Malformation Consortium (grant number U54NS065705 ) is a part of the NIH Rare Diseases Clinical Research Network, supported through the collaboration between the NIH Office of Rare Diseases Research at the National Center for Advancing Translational Science and the National Institute of Neurological Disorders and Stroke. Conceptualization: AMC, JP; Data Curation: JT, JP; Formal Analysis: JT, JP; Funding Acquisition: AMC, JP; Investigation: JT, LPF, MM, CAP, BAC, AMC, JP; Methodology: JT, LPF, MM, CAP, BAC, AMC, JP; Project Administration: AMC, JP; Resources: AMC, JP; Software: JT, JP; Supervision: AMC, JP; Validation: JT, LPF, MM, CAP, BAC, AMC, JP; Visualization: MM, CAP, BAC, AMC; Writing - Original Draft Preparation: JT, AMC, JP; Writing - Review and Editing: AMC, JP