Abstract

BackgroundAlthough the highest diversity of birds occurs in tropical regions, little is known about the genetic mating systems of most tropical species. We describe microsatellite markers isolated in the chestnut-crested yuhina (Staphida everetti), endemic to the island of Borneo, and the grey-throated babbler (Stachyris nigriceps), widely distributed across Southeast Asia. Both species belong to the avian family Timaliidae and are highly social, putatively cooperatively breeding birds in which helpers attend the nests of members of their social group. We obtained DNA from individuals in social groups breeding in Kinabalu Park, Malaysian Borneo.ResultsWe used a shotgun sequencing approach and 454-technology to identify 36 microsatellite loci in the yuhina and 40 in the babbler. We tested 13 primer pairs in yuhinas and 20 in babblers and characterized eight polymorphic loci in 20 unrelated female yuhinas and 21 unrelated female babblers. Polymorphism at the yuhina loci ranged from 3 to 9 alleles, observed heterozygosities from 0.58 to 1.00, and expected heterozygosities from 0.64 to 0.81. Polymorphism at the babbler loci ranged from 3 to 12 alleles, observed heterozygosities from 0.14 to 0.90 and expected heterozygosities from 0.14 to 0.87. One locus in the yuhina deviated significantly from Hardy–Weinberg equilibrium. We detected nonrandom allele associations between two pairs of microsatellite loci in each species.ConclusionsMicrosatellite markers will be used to describe the genetic mating system of these socially complex species and to measure genetic parentage and relatedness within social groups.

Highlights

  • The highest diversity of birds occurs in tropical regions, little is known about the genetic mating systems of most tropical species

  • *Correspondence: KaiserS@si.edu Center for Conservation and Evolutionary Genetics, Smithsonian Conservation Biology Institute, National Zoological Park, Washington, DC 20013, USA. Both species belong to the Old World avian family Timaliidae, which is compromised of oscine passerine birds generally known as babblers [6]

  • The chestnut-crested yuhina is a highly social bird that forages throughout the canopy in large single-species flocks of 10–30 birds [4] and the grey-throated babbler forages in small groups of 5–8 individuals during the breeding months [4, 7]

Read more

Summary

Results

We used a shotgun sequencing approach and 454-technology to identify 36 microsatellite loci in the yuhina and 40 in the babbler. We tested 13 primer pairs in yuhinas and 20 in babblers and characterized eight polymorphic loci in unrelated female yuhinas and unrelated female babblers. Polymorphism at the yuhina loci ranged from 3 to 9 alleles, observed heterozygosities from 0.58 to 1.00, and expected heterozygosities from 0.64 to 0.81. Polymorphism at the babbler loci ranged from 3 to 12 alleles, observed heterozygosities from 0.14 to 0.90 and expected heterozygosities from 0.14 to 0.87. One locus in the yuhina deviated significantly from Hardy–Weinberg equilibrium. We detected nonrandom allele associations between two pairs of microsatellite loci in each species

Conclusions
F: AGCAATAGGACTGACACAAGGT R: AGTCTTGATTTCCCCACTTTGTC F: CCAGCCTCTGAACTGGTCTG R
F: CTCTCCCTCCTCTCCGCC
11. Mayer C
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call