Hypoxia-inducible factor 2α (HIF-2α) promotes colon cancer growth by potentiating Yes-associated protein 1 (YAP1) activity

Xiaoya Ma,Huabing Zhang,Xiang Xue,Yatrik M Shah

doi:10.1074/jbc.m117.805655

Abstract

Colorectal cancer (CRC) is the third-leading cause of cancer mortality in the United States and other industrialized countries. A hypoxic microenvironment is a hallmark for solid tumors. The hypoxia-induced signal transduction is transcriptionally mediated by hypoxia-inducible factor (HIF). Three major HIF isoforms, HIF-1α, HIF-2α, and HIF-3α, are present in the intestine. Our previous work demonstrates that HIF-2α is essential for CRC growth and progression. However, the mechanisms mediating cell proliferation after hypoxia or HIF-2α activation in CRC are unclear. Data mining of RNA-Seq experiments with mouse models of intestinal HIF-2α or Yes-associated protein 1 (YAP1) overexpression indicates a significant overlap of genes in these conditions. YAP1 is a transcriptional co-activator in the Hippo signaling pathway, and YAP1-induced transcriptional responses are essential in cancer cell proliferation. Here, we report that HIF-2α robustly increases YAP1 expression and activity in CRC-derived cell lines and in mouse models. The potentiation of YAP1 activity by HIF-2α was not via canonical signaling mechanisms such as Src (non-receptor tyrosine kinase), PI3K, ERK, or MAPK pathways. Moreover, we detected no direct interaction of HIF-2α with YAP1. Of note, YAP1 activation was critical for cancer cell growth under hypoxia. Our findings indicate that HIF-2α increases cancer cell growth by up-regulating YAP1 activity, suggesting that this pathway might be targeted in potential anti-cancer approaches for treating CRC patients.

Highlights

Colorectal cancer (CRC) is the third-leading cause of cancer mortality in the United States and other industrialized countries
Our findings indicate that hypoxia-inducible factor (HIF)-2␣ increases cancer cell growth by up-regulating Yes-associated protein 1 (YAP1) activity, suggesting that this pathway might be targeted in potential anti-cancer approaches for treating CRC patients
In the HIF2␣LSL/LSL;VillinCre mice a significant increase in total-YAP1 protein levels and YAP1 target genes, Cyr61, Ctgf, and Tgfbr2 were observed, whereas HIF-1␣ overexpression decreased YAP1 target genes Tgfbr2 and Tead1 (Fig. 2A). This indicates that HIF-2␣, but not HIF-1␣, increases YAP1 activity

Summary

Results

To investigate the mechanisms of HIF-2␣-induced cell proliferation, RNA-sequencing data were analyzed in a mouse model of HIF-2␣ overexpression in intestinal epithelial cells (HIF2␣LSL/LSL;VillinCre) [24]. In the HIF2␣LSL/LSL;VillinCre mice a significant increase in total-YAP1 protein levels and YAP1 target genes, Cyr, Ctgf, and Tgfbr were observed, whereas HIF-1␣ overexpression decreased YAP1 target genes Tgfbr and Tead (Fig. 2A) This indicates that HIF-2␣, but not HIF-1␣, increases YAP1 activity. Western blotting and immunofluorescent staining showed that HIF-2␣ overexpression significantly increased both total YAP1 (T-YAP1) and phospho-YAP1 (p-YAP1) protein levels and nuclear YAP1 localization without altering the p-YAP/T-YAP1 ratio (Fig. 1, E and F) These data confirm that HIF-2␣ increases the expression of YAP1 target genes. Immunofluorescence staining with Ki67 and H&E staining showed increased cell proliferation in CDXERT2CreApcF/F mice, whereas HIF-2␣ knock-out did not alter the tissue proliferation (Fig. 4, C and D) These results indicate that HIF-2␣ is not essential for the increase of YAP1 and its target gene expression in sporadic CRC models. This result demonstrates that YAP1 is essential for HIF-2␣ and hypoxia-mediated growth

Discussion

Animals and treatments

GTTGTCGACGACGAGCG GCATCCGTACTCCCAAAATCTC CGAGGTGGAGTTGACGAGAAAC

Cell culture and proliferation assays

Luciferase assay

Western blot analysis