Abstract
The proliferating cell nuclear antigen (PCNA) is a highly conserved protein required for the assembly of the DNA polymerase delta (pol delta) holoenzyme. Because PCNAs from Saccharomyces cerevisiae and human do not complement each other using in vitro or in vivo assays, hybrids of the two proteins would help identify region(s) involved in the assembly of the pol delta holoenzyme. Two mutants of human PCNA, HU1 (D21E) and HU3 (D120E), and six hybrids of human and S. cerevisiae PCNA, HC1, HC5, CH2, CH3, CH4, and CH5, were prepared by swapping corresponding regions between the two proteins. In solution, all PCNA assembled into trimers, albeit to different extents. These PCNA variants were tested for stimulation of pol delta and in vitro replication of M13 and SV40 DNA as well as to stimulate the ATPase activity of replication factor C (RF-C). Our data suggest that in addition to the interdomain connecting loop and C terminus, an additional site in the N terminus is required for pol delta interaction. PCNA mutants and hybrids that stimulated pol delta and RF-C were deficient in M13 and SV40 DNA replication assays, indicating that PCNA-induced pol delta stimulation and RF-C-mediated loading are not sufficient for coordinated DNA synthesis at a replication fork.
Highlights
The proliferating cell nuclear antigen (PCNA) is a highly conserved protein required for the assembly of the DNA polymerase delta holoenzyme
Taking a lead from previous work, where cerevisiae PCNA (cPCNA) was unable to complement human PCNA (hPCNA) in simian virus 40 (SV40) DNA replication in vitro [53], when both proteins existed as trimers in solution [17, 55], we hypothesized that hybrids of the two proteins would be equivalent to large deletions within hPCNA without disrupting the trimeric ring
This would allow identification of functional regions in hPCNA involved in the assembly of the pol ␦ holoenzyme at a replication fork
Summary
GACGTTCGGAGCTAGGTACCTATTGGACATCA a Underlined nucleotides are those mutated from the wt sequence. b Amino acid replacements are shown in upper case, and nucleotide changes are in lower case. The Saccharomyces cerevisiae homolog of PCNA, pol, shares 35% sequence identity with the human PCNA (hPCNA) and is able to enhance the processivity of the mammalian pol ␦ [52], but it is unable to complement hPCNA in SV40 DNA replication in vitro [53] This suggests that S. cerevisiae PCNA (cPCNA) has very low affinity for mammalian pol ␦ and RF-C, even though both yeast and mammalian PCNAs exist as trimers [54, 55]. We argued that by swapping different regions between h- and cPCNA, it should be possible to generate hybrids that were equivalent to large deletions in hPCNA while retaining a trimeric structure Functional analyses of these hybrids would help to define region(s) of hPCNA involved in DNA replication. We introduced mutations in the highly conserved region of PCNA and generated a set of novel human-S. cerevisiae PCNA hybrids These PCNAs were examined for their ability to stimulate pol ␦ and RF-C or to function in DNA replication assays. Our data suggest that assembly of the pol ␦ holoenzyme may require participation of other proteins at a replication fork
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
