Human Exonuclease 1 Functionally Complements Its Yeast Homologues in DNA Recombination, RNA Primer Removal, and Mutation Avoidance

Junzhuan Qiu,Ying Qian,Victoria Chen,Min-Xin Guan,Binghui Shen

doi:10.1074/jbc.274.25.17893

Junzhuan Qiu, Ying Qian + Show 3 more

Open Access

https://doi.org/10.1074/jbc.274.25.17893

Copy DOI

Abstract

Yeast exonuclease 1 (Exo1) is induced during meiosis and plays an important role in DNA homologous recombination and mismatch correction pathways. The human homolog, an 803-amino acid protein, shares 55% similarity to the yeast Exo1. In this report, we show that the enzyme functionally complements Saccharomyces cerevisiae Exo1 in recombination of direct repeat DNA fragments, UV resistance, and mutation avoidance by in vivo assays. Furthermore, the human enzyme suppresses the conditional lethality of a rad27Delta mutant, symptomatic of defective RNA primer removal. The purified recombinant enzyme not only displays 5'-3' double strand DNA exonuclease activity, but also shows an RNase H activity. This result indicates a back-up function of exonuclease 1 to flap endonuclease-1 in RNA primer removal during lagging strand DNA synthesis.

Highlights

Yeast exonuclease 1 (Exo1) is induced during meiosis and plays an important role in DNA homologous recombination and mismatch correction pathways
Sequence and in Vitro Functional Conservation of Eukaryotic 5Ј-Exonuclease 1—The enzyme has so far been identified in S. pombe, S. cerevisiae, D. melanogaster, and human (44 –52)
It is possible that the truncated protein purified from S. pombe lacks a structure responsible for 5Ј-3Ј single strand DNA exonuclease activity

Summary

EXPERIMENTAL PROCEDURES

Materials—A cDNA clone (number 843301) harboring a putative human exonuclease 1 was obtained from ATCC (Manassas, VA). Overexpression and Purification of hExo1—Full-length human EXO1 coding sequence was subcloned into pET-28a vector (Novagen) using the cDNA clone harboring hEXO1 and PCR primers 5exo and 3exo containing NheI and SalI sites (5exo, GACTGTGCTAGCATGGGGATACAGGGATTG and 3exo, TGTCACTGTCGACAATCCAAAGTTTTTCCAG), respectively, yielding pET-HEX. Both pET-28a and pET-HEX were transformed into BL21 (DE3) cells (Novagen). For the wild type and exo null mutants, 100 ␮l of saturated culture cells was optimal and plated onto SD-HIS medium. Suppression Analysis—The pDB overexpression vector with or without insertion of either HEX1 or ScEXO1 was transformed into the rad null mutant and wild type strain of S. cerevisiae. Mutation rate for each strain was calculated from six independent experiments

RESULTS

Relative frequency

DISCUSSION

Relative rate