Abstract
The five potential N-glycosylation sites (sequons) of human acid beta-glucosidase were individually mutated to determine site occupancy and the effect of site occupancy on selected catalytic and stability properties of this enzyme. Each N-glycosylation consensus sequence [Asn-Xaa-(Ser/Thr)] was obliterated by individually substituting glutamine (Q) for asparagine (N). By expression of the normal and mutated cDNAs in insect (Sf9) and COS-1 cells and subsequent immunoblotting with anti-human acid beta-glucosidase antibodies, the four sequons at Asn-19, Asn-59, Asn-146, and Asn-270 were shown to be glycosylated in either source. The sequon at Asn-462 was never occupied. The mutant enzymes N59Q, N146Q, and N270Q were catalytically active and had normal interactions with active site-directed inhibitors as well as with the activators, phosphatidylserine and saposin C. Of the occupied sequons, N-glycosylation of the first was critical to the synthesis of a catalytically active enzyme. Alteration of this sequon, Asn-19-Ala-20-Thr-21, by the substitutions N19Q, N19D, N19E, or T21G led to a lack of glycosylation at this site. Enzymes containing N19Q, N19E, or T21G had significant decreases (3- to 60-fold) in intrinsic enzyme activity. The N19D enzyme had nearly normal catalytic activity and had enhanced activation by phosphatidylserine. These results show that sequon occupancy as well as steric effects at residue 19 are important for the development of an active conformer of this enzyme. This is the first example of a lysosomal hydrolase that requires sequon occupancy for the synthesis of a catalytically active enzyme.
Highlights
From the $Division of Medical and Molecular Genetics, Departmentof Pediatrics, Mount SinaiSchool of Medicine, New York, New York 10029 and the §Division of Human Genetics, Children’s HospitalMedical Center, Cincinnati, Ohio 45229
N59Q indicates a glutamine substitution for an asparagine a t amino acid 59 of the mature acid 8-glucosidase.G-3 refers to the human acid 8-glucosidase expressed from a cDNA containing N19Q, N59Q, N270Q, and N462Q mutations, but with preservation of the third glycosylation site which begins at Asn-146
The present studiesshow that thefirst four N-glycosylation consensus sequences, sequons, of human acid 0-glucosidase are normally occupied and that thecatalytic activity of this enzyme depends on the occupancy and/or the naturoef amino acid 19
Summary
Normal 5’TGGTGTGTGTCTGCaTGCCACATACTGTGAC3’ Mutant 5’TGGTGTGTGTCTGCcAi%CCACATACTGTGAC3’ Normal 5’TGGTGTGTGTCTGC@TGCCACATACTGTGAC3’ Mutant 5’TGGTGTGTGTCTGCGAAGCCACATACTGTGAC3’ Normal 5’TGGTGTGTGTCTGC@TGCCACATACTGTGAC3’ Mutant S’TGGTGTGTGTCTGCAATGCCGGATACTGTGAC3’. The glycosylation consensus sequence, Asn-Xaa-Ser/Thr, by creating co- levels of acid 8-glucosidase activity and protein expressed from indons for Gln instead of Asn. Additional cDNAs encoded the substi- dependent recombinant viral isolates for each cDNAwere monitored tution of Asn to Asp or Asn to Glu at the sequon located at amino by enzyme assay and immunoblots, 3 days after infection. Additional cDNAs encoded the substi- dependent recombinant viral isolates for each cDNAwere monitored tution of Asn to Asp or Asn to Glu at the sequon located at amino by enzyme assay and immunoblots, 3 days after infection For these acid 19 (N19D, N19E),of Thr toGly a t amino acid 21 (T21G), orof studies, titerswere adjusted toachieve maximal specific activities [5]. The times of incubation a t 50 "Cthat resulted in 50% loss of the initial activity ( t s )were determined [5]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
