Abstract
Although ions play important roles in the cell and chloroplast metabolism, little is known about ion transport across the chloroplast envelope. Using a proteomic approach specifically targeted to the Arabidopsis chloroplast envelope, we have identified HMA1, which belongs to the metal-transporting P1B-type ATPases family. HMA1 is mainly expressed in green tissues, and we validated its chloroplast envelope localization. Yeast expression experiments demonstrated that HMA1 is involved in copper homeostasis and that deletion of its N-terminal His-domain partially affects the metal transport. Characterization of hma1 Arabidopsis mutants revealed a lower chloroplast copper content and a diminution of the total chloroplast superoxide dismutase activity. No effect was observed on the plastocyanin content in these lines. The hma1 insertional mutants grew like WT plants in standard condition but presented a photosensitivity phenotype under high light. Finally, direct biochemical ATPase assays performed on purified chloroplast envelope membranes showed that the ATPase activity of HMA1 is specifically stimulated by copper. Our results demonstrate that HMA1 offers an additional way to the previously characterized chloroplast envelope Cu-ATPase PAA1 to import copper in the chloroplast.
Highlights
Tel.: 33-4-3878-4986; Fax: 33-4-38785091; E-mail: nrolland@cea.fr. 4 The abbreviations used are: SOD, superoxide dismutase; Cu/Zn-SOD, Cu/Zn superoxide dismutase; PS, photosystem; ICP-AES, inductively coupled plasma-atomic emission spectrometry; TMs, transmembrane segments; GFP, green fluorescent protein; cofactors for several enzymatic reactions: zinc is associated with chloroplast SOD, methionine synthase, carbonic anhydrase; manganese is required for oxygen evolution in photosynthesis; whereas iron is a cofactor of iron SOD and is found in iron-sulfur clusters of cytochrome b6 f complex, ferredoxin, photosystem I (PSI), and photosystem II (PSII) [2]
HMA1 Is a P1B-ATPase of the Chloroplast Envelope—Proteomic analyses of chloroplast envelope membranes (Refs. 6, 40, and unpublished results) led to the identification of hundreds of proteins, among which we found HMA1 that belongs to the P1B-ATPases, a subgroup of the P-type ATPases involved in metal ions transport [3]
We demonstrated its chloroplast envelope localization using both transient expression in Arabidopsis leaves and cultured cells and Western blot analyses performed on subplastidial fractions (Fig. 2)
Summary
Plant Material and Growth Conditions—Arabidopsis plants, Wassilevskija background (Ws), were germinated in Petri dishes containing solidified medium (Murashige and Skoog (MS), 1% (w/v) sucrose, and 1% (w/v) agarose) for 2 weeks before transfer to soil. We extracted the entire cassette Pro35S-HMA1-GFP-Nos Ter using EcoRI and a partial HindIII digestion This fragment was purified and inserted into the EcoRI-HindIII-digested pEL103 binary vector (kanamycin resistance to transform wild-type plants). The open reading frame of HMA1 was amplified by PCR using the primers 5ЈHMA1: CCATGGAACCTGCAACTCTTACTCGTTC and 3ЈHMA1: CCCCCTAATGTGCAGAGCTTAAACTGTTGC, subcloned in the pCR-XL-TOPO vector (Invitrogen) and sequenced This plasmid was modified to insert the NotI restriction site, allowing the subsequent cloning of the full-length cDNA in the pYES2 yeast expression vector (Invitrogen). Y00000) was transformed with the different plasmids and grown on synthetic medium as described in Gravot et al [25], except that the precultures were performed with glucose 2% (w/w) as carbon source to repress the protein expression. Sequence data from this article have been deposited with the GenBank data library under accession number AY907350 for HMA1 (At4g37270)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
