Highly Efficient Mouse Genome Editing by CRISPR Ribonucleoprotein Electroporation of Zygotes

Lin He,Sean Chen,Angus Yiu-Fai Lee,Benjamin Lee,Andrew J Modzelewski

doi:10.1074/jbc.m116.733154

Lin He, Sean Chen + Show 3 more

Open Access

https://doi.org/10.1074/jbc.m116.733154

Copy DOI

Abstract

The CRISPR/Cas9 system has been employed to efficiently edit the genomes of diverse model organisms. CRISPR-mediated mouse genome editing is typically accomplished by microinjection of Cas9 DNA/RNA and single guide RNA (sgRNA) into zygotes to generate modified animals in one step. However, microinjection is a technically demanding, labor-intensive, and costly procedure with poor embryo viability. Here, we describe a simple and economic electroporation-based strategy to deliver Cas9/sgRNA ribonucleoproteins into mouse zygotes with 100% efficiency for in vivo genome editing. Our methodology, designated as CRISPR RNP Electroporation of Zygotes (CRISPR-EZ), enables highly efficient and high-throughput genome editing in vivo, with a significant improvement in embryo viability compared with microinjection. Using CRISPR-EZ, we generated a variety of editing schemes in mouse embryos, including indel (insertion/deletion) mutations, point mutations, large deletions, and small insertions. In a proof-of-principle experiment, we used CRISPR-EZ to target the tyrosinase (Tyr) gene, achieving 88% bi-allelic editing and 42% homology-directed repair-mediated precise sequence modification in live mice. Taken together, CRISPR-EZ is simple, economic, high throughput, and highly efficient with the potential to replace microinjection for in vivo genome editing in mice and possibly in other mammals.

Highlights

Classic mouse genome engineering techniques utilize homologous recombination to introduce precise modifications in embryonic stem cells [1,2,3,4]
To overcome the costly and laborious nature of microinjection, we developed CRISPR-EZ (CRISPR RNP Electroporation of Zygotes), an electroporationbased method to deliver Cas9/single guide RNA (sgRNA) RNPs into mouse zygotes for in vivo genome editing with high efficiency, high throughput, and high viability (Fig. 1A)
To improve CRISPR genome editing in mice, we developed CRISPR-EZ, an electroporationbased technology, to deliver Cas9/sgRNA RNPs into mouse zygotes to engineer genome editing

Summary

CRISPR RNP Electroporation of Zygotes

SgRNA, ssDNA HDR donor, and PCR primer sequences in CRISPR-EZ experiments sgRNA sequences sgTyr sgCdh sgCdk sgKif sgMecp L sgMecp R sgSox. TACCAGAGCGGCCCGGTGCCCGGCACGGCCATTAACGGCACACTGCCCCTGTCGCACATGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGACAGCACCTGAGGGCTGGACTGCGAACTGGAGAAGGGGAGAGATTTTCAAAGAGATACAAGGGAATTG the Cas9/sgRNA delivery into mouse zygotes to enable high efficiency and high-throughput genome editing in vivo. Compared with the microinjection-based technology, CRISPR-EZ significantly improves embryo/pup survival following Cas and sgRNA delivery. Using CRISPR-EZ, we consistently obtained high efficiency mouse genome editing for multiple genes, and we successfully generated mouse embryos with a variety of editing schemes, including indel mutations, point mutations, genomic deletions, and small precise insertions. CRISPR-EZ is a simple, economic, high throughput, and highly efficient technique for genome editing in vivo, which can replace the traditional microinjection-dependent genome editing technique in mice and possibly in other mammalian species

Experimental Procedures

Embryos assayed by RFLP

Coat color Albino mRNA injection

Results

Type of editing events detected by RFLP analyses

Discussion