Abstract
γδ T cells are a relatively rare subset of lymphocytes in the human peripheral blood, but they play important roles at the interface between the innate and the adaptive immune systems. The γδ T cell lineage is characterized by a signature γδ T cell receptor (γδTCR) that displays extensive sequence variability originated by DNA rearrangement of the corresponding V(D)J loci. Human γδ T cells comprise Vγ9Vδ2 T cells, the major subset in the peripheral blood; and Vδ1+ T cells, the predominant subpopulation in the post-natal thymus and in peripheral tissues. While less studied, Vδ1+ T cells recently gathered significant attention due to their anti-cancer and anti-viral activities. In this study we applied next-generation sequencing (NGS) to analyse the γδTCR repertoire of highly (FACS-)purified Vδ1+ T cells from human thymic biopsies. Our analysis reveals unsuspected aspects of thymically rearranged and expressed (at the mRNA level) TRG and TRD genes, thus constituting a data resource that qualifies previous conclusions on the TCR repertoire of γδ T cells developing in the human thymus.
Highlights
Background & Summary γδT cells constitute a small (~5–10%) but unique subpopulation of T cells
Contrary to their αβ counterparts, there is little evidence supporting the hypothesis of human γδ T cells being positively and/or negatively selected in the thymus
Peripheral blood was collected from buffy coat cells, diluted with 1 volume of PBS (Invitrogen Life Technologies), and separated on a Histopaque-1077 density gradient. γδ T cells were first isolated by magnetic cell sorting (MACS) using a negative selection strategy; and stained with anti-TCRVδ1, anti-TCRVδ2, anti-CD3 and anti-TCRαβ mAbs; and FACS-sorted (CD3+ TCRVδ1+) to >98% purity in FACS Aria III (BD Biosciences)
Summary
CDR3 TRG and TRD sequencing amplicons were generated as described previously[4] using 7 μl cDNA template. Illumina adaptor sequences (GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG and TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG) were added as overhangs All forward primers for either TRG or TRD were combined in equal concentrations. PCR samples were run for gel electrophoresis on a 1%-Agarose-Gel, PCR amplicons (350 bps for TRG and 250 bps) were excised and gel-purified according to the QIAquick gel extraction kit (Qiagen). Individual 10 μl purified PCR amplicons were combined with 10 μl Advantage II PCR buffer (Clontech), 5 μl 10 mM dNTP (Clontech), 5 μl N50X and 5 μl N70X index primer (Nextera Index Kit, Illumina), 1 μl Advantage II polymerase (Clontech) and 30 μl dH2O for eight additional PCR cycles. According to the Illumina Denature and Dilute Library guidelines the library was
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
