High frequency of the expanded C9ORF72 hexanucleotide repeat in familial and sporadic Greek ALS patients

Kin Y Mok,Georgios Koutsis,Lucia V Schottlaender,James Polke,Marios Panas,Henry Houlden

doi:10.1016/j.neurobiolaging.2012.02.021

Abstract

An intronic expansion of a hexanucleotide GGGGCC repeat in the C9ORF72 gene has recently been shown to be an important cause of amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD) in familial and sporadic cases. The frequency has only been defined in a small number of populations where the highest sporadic rate was identified in Finland (21.1%) and the lowest in mainland Italy (4.1%). We examined the C9ORF72 expansion in a series of 146 Greek ALS cases, 10.95% (n = 16) of cases carried the pathological expansion defined as greater than 30 repeats. In the 10 familial ALS probands, 50% (n = 5) of them carried a pathologically large expansion. In the remaining 136 sporadic ALS cases, 11 were carriers (8.2%). None of the 228 Greek controls carried an expanded repeat. The phenotype of our cases was spinal (13/16) or bulbar (3/16) ALS, the familial cases were all spinal ALS and none of our cases had behavioral frontotemporal dementia. Expansions in the C9ORF72 gene therefore represent a common cause of ALS in Greece and this test will be diagnostically very important to implement in the Greek population. The frequency is higher than other populations with the exception of Finland and this may be due to Greece being a relatively isolated population.

Highlights

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder characterized by degeneration of the brain and spinal cord leading to weakness, wasting, bulbar problems, and usually death within 3 years (Clarke et al, 2009)
Further analysis of the incidence in sporadic ALS suggests a marked difference across Europe, the highest prevalence being in Finland (21.1%), the UK (7%), Germany (5.2%), Belgium (5%), and the lowest in Italy at 4.1% (Cooper-Knock, 2012; DeJesus-Hernandez et al, 2011; Gijselinck et al, 2012; Renton et al, 2011; Traynor, B.J., personal communication, C9ORF72 hexanucleotide repeat expansion in sporadic ALS and frontotemporal dementia (FTD) around the world, 2012)
100 ng of genomic DNA was amplified with a final volume of 20 ␮L containing 10 ␮L FastStart polymerase chain reaction (PCR) MasterMix (Roche, Foster City, CA, USA), 0.18 mM 7-deaza dGTP, 1xQiagenQ solution, 10% dimethyl sulfoxide (DMSO), 0.7 ␮M reverse primer consisting of 4 GGGGCC repeats and an anchor tail (TACGCATCCCAGTTTGAGACGGGGGCCGGGGCCGGGGCCGGGG), 1.4 ␮M 6FAM-fluorescent-primer located 280 base pairs 3= prime to the repeat sequence (AGTCGCTAGAGGCGAAAGC) and 1.4 ␮M anchor primer corresponding to the anchor tail of the reverse primer (TACGCATCCCAGTTTGAGACG)

Summary

Introduction

Amyotrophic lateral sclerosis (ALS) is a progressive neurodegenerative disorder characterized by degeneration of the brain and spinal cord leading to weakness, wasting, bulbar problems, and usually death within 3 years (Clarke et al, 2009). Two research groups identified a pathogenic GGGGCC hexanucleotide repeat expansion in intron-1 of the C9ORF72 gene as an important cause for both familial and sporadic ALS (DeJesus-Hernandez et al, 2011; Renton et al, 2011). Further analysis of the incidence in sporadic ALS suggests a marked difference across Europe (north to south), the highest prevalence being in Finland (21.1%), the UK (7%), Germany (5.2%), Belgium (5%), and the lowest in Italy at 4.1% (Cooper-Knock, 2012; DeJesus-Hernandez et al, 2011; Gijselinck et al, 2012; Renton et al, 2011; Traynor, B.J., personal communication, C9ORF72 hexanucleotide repeat expansion in sporadic ALS and FTD around the world, 2012). These findings further highlight the importance of TDP-43 in FTD and ALS

Methods

Results

Conclusion