Abstract
Liver-specific insulin receptor knock-out (LIRKO) mice display hyperinsulinemia, abnormal glucose metabolism, and progressive liver dysfunction. In addition, circulating leptin levels appear to be increased more than 10-fold. However, food intake, body weight, and adipose mass are not significantly altered in LIRKO mice compared with wild-type littermates. Using a ligand immunofunctional assay, we found that the apparent increase in circulating leptin in LIRKO mice is because of an 80-fold increased serum level of soluble leptin receptor. Gene expression analysis by microarray and real time PCR reveals the liver as the source of soluble leptin receptor in LIRKO mice, with an increase in expression of the short (Ob-Ra), long (Ob-Rb), and soluble (Ob-Re) forms of the leptin receptor. Direct control of leptin receptor expression by insulin could also be demonstrated in isolated hepatocytes from normal mice. Despite the markedly increased levels of leptin receptor in their circulation, LIRKO mice exhibit normal or even enhanced leptin sensitivity, as assessed by their physiological and molecular responses to exogenous leptin administration and their lower base-line hypothalamic levels of SOCS3 mRNA. Thus, insulin signaling in the liver plays an important role in control of leptin receptor expression and shedding. In the LIRKO mouse, this is lost, leading to markedly increased leptin receptors into the circulation. These high levels of circulating leptin receptor bind leptin and likely alter its clearance, but do not inhibit leptin action and may actually potentiate leptin action. In this manner, insulin signaling in liver plays an important role in leptin homeostasis and fine modulation of leptin action.
Highlights
Leptin is a major sensor of body fat stores
Liver-specific insulin receptor knock-out (LIRKO) Mice Are Characterized by Hyperleptinemia in the Absence of Obesity—As noted previously, LIRKO mice are of normal body weight
The presence of high circulating leptin levels with normal weight in LIRKO mice suggested the possibility of some factor(s) that might (TBP) sense, acccttcaccaatgactcctatg; TBP antisense, tgactg- modify the action of leptin, and one consideration in this regard cagcaaatcgcttgg
Summary
Mice—LIRKO mice were generated using the Cre/loxP system for site-specific excisional DNA recombination [17] by crossing mice carrying a floxed insulin receptor [IRlox/lox] and albumin-Cre transgenic mice heterozygous for the floxed allele IRlox/ϩ as described previously [9]. Total serum leptin was measured by ELISA (R & D Systems). Twenty microliters of murine rsOb-R (R & D Systems) standards ranging between 10 pM and 1000 nM or serum samples were added to the wells and incubated with an excess of biotinylated leptin in assay buffer (1% goat ␥-globulin, 0.1% bovine serum albumin, and 0.05% Tween 20 in PBS) overnight at 4 °C. The assay detected sOb-R in a range between 20.7 pM and 769 nM, and spiking of 3.1 M leptin yielded a mean recovery of 90.1%. Results of dilution and sOb-R spiking experiments demonstrated a recovery of 103.0 Ϯ 10.7% (n ϭ 4) and 94.2 Ϯ 11.9% (n ϭ 3), respectively, which is within the expected range for immunoassays. Western blot analysis of sOb-R in sera of control and LIRKO mice was performed as described previously [20]. Results are expressed as mean Ϯ S.E. unless otherwise indicated
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
