Hereditary neuropathy with liability to pressure palsies (HNPP) patients of Korean ancestry with chromosome 17p11.2-p12 deletion.

Seung Min Kim,Ki Wha Chung,Kee Duk Park,Il Nam Sunwoo,Eui Soo Yoon,Byung Ok Choi,Jung Young Choi

doi:10.1038/emm.2004.4

Abstract

Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant inherited disorder characterized by recurrent pressure palsies. Most HNPP patients have a 1.5 mb deletion in chromosome 17p11.2-p12. The present study aimed at evaluating the deletion of the 17p11.2-p12 region in Korean subjects with families exhibiting HNPP phenotype, and to determine the clinical, electrophysiological and morphological aspects specifically associated with this deletion in HNPP patients. By genotyping six microsatellite markers (D17S921, D17S955, D17S1358, D17S839, D17S122 and D17S261), HNPP with the deletion was observed in 79% (19 of 24) of HNPP families. Nerve conduction studies were performed in 35 HNPP patients from these 19 families. The observed HNPP deletion frequency in Koreans is consistent with findings in other populations. Disease onset occurred at a significantly earlier age in patients with recurrent pressure palsies than in those with a single attack (P < 0.01). Nerve conduction studies demonstrated diffuse mild to moderate slowing of nerve conduction velocities that were worse over the common entrapment sites, regardless of the clinical manifestations. A long duration of compound muscle action potentials without a conduction block or a temporal dispersion is a characteristic of this disease. A sural nerve biopsy with teasing was performed in four patients, and tomacula of the myelin sheath was found in 56.4%. Our findings appear to support the existence of a phenotype/genotype correlation in HNPP patients of Korean ancestry with the deletion, and suggest that HNPP patients with earlier symptom onset face an increased chance of having recurrent attacks.

Highlights

Hereditary neuropathy with liability to pressure palsies (HNPP) patients are characterized by recurrent pressure palsies and sausage-like swellings of the myelin sheaths by nerve biopsy (Behse et al, 1972)
Mutations and the altered gene dosage of the peripheral myelin protein 22 (PMP22) gene are regarded as the main reasons for hereditary peripheral neuropathies, and are found in approximately 80% of all cases (Mariman et al, 1994; Nelis et al, 1996; Timmerman et al, 1997)
We investigated the clinical differences between 35 HNPP patients with chromosome 17p11.2-p12 deletion and 34 Charcot-Marie-Tooth disease type 1A (CMT1A) patients with these duplication

Summary

Introduction

Hereditary neuropathy with liability to pressure palsies (HNPP) patients are characterized by recurrent pressure palsies and sausage-like swellings (tomacula) of the myelin sheaths by nerve biopsy (Behse et al, 1972). Deletion of the chromosome 17p11.2-p12 region including peripheral myelin protein 22 (PMP22) frequently provides the genetic basis of hereditary peripheral demyelinating neuropathy like HNPP (Verhagen et al, 1993; Guern et al, 1994). Mutations and the altered gene dosage of the PMP22 gene are regarded as the main reasons for hereditary peripheral neuropathies, and are found in approximately 80% of all cases (Mariman et al, 1994; Nelis et al, 1996; Timmerman et al, 1997). Deletion is the most frequent causative mutation, but is not found in all cases of HNPP (Chance et al, 1993). Communication defaults between Schwann cells and neurons, due to genetic defects, frequently lead to these peripheral neuropathies (Lobsiger et al, 2002). In identified HNPP deletion families, clinical, electrophysiological and morphological characteristics of the disease were investigated

Materials and Methods

Findings

F: CTAGGCACTGAAGCCAGGAAG