Heat Shock Protein 70 and 90 Genes in the Harmful Dinoflagellate Cochlodinium polykrikoides: Genomic Structures and Transcriptional Responses to Environmental Stresses.

Ruoyu Guo,Seok Hyun Youn,Jang-Seu Ki

doi:10.1155/2015/484626

Abstract

The marine dinoflagellate Cochlodinium polykrikoides is responsible for harmful algal blooms in aquatic environments and has spread into the world's oceans. As a microeukaryote, it seems to have distinct genomic characteristics, like gene structure and regulation. In the present study, we characterized heat shock protein (HSP) 70/90 of C. polykrikoides and evaluated their transcriptional responses to environmental stresses. Both HSPs contained the conserved motif patterns, showing the highest homology with those of other dinoflagellates. Genomic analysis showed that the CpHSP70 had no intron but was encoded by tandem arrangement manner with separation of intergenic spacers. However, CpHSP90 had one intron in the coding genomic regions, and no intergenic region was found. Phylogenetic analyses of separate HSPs showed that CpHSP70 was closely related with the dinoflagellate Crypthecodinium cohnii and CpHSP90 with other Gymnodiniales in dinoflagellates. Gene expression analyses showed that both HSP genes were upregulated by the treatments of separate algicides CuSO4 and NaOCl; however, they displayed downregulation pattern with PCB treatment. The transcription of CpHSP90 and CpHSP70 showed similar expression patterns under the same toxicant treatment, suggesting that both genes might have cooperative functions for the toxicant induced gene regulation in the dinoflagellate.

Highlights

Dinoflagellate algae are a eukaryotic protist and are the most important primary producer in aquatic environments
The primers used in the CpHSP70 and CpHSP90 genomic sequence determination were designed according to cDNA sequence (Table 1)
The HSP90 contains five conserved motifs defined as HSP90 signature motif [34]; these five signature motifs NKEIFLRELISNASDALDKIRY, LGTIAKSGT, IGQFGVGFYSAYLV, IKLYVRRVFI, and VVDSEDLPLNISRE were identified by comparison with other HSP90s (Figure 1(a))

Summary

Introduction

Dinoflagellate algae are a eukaryotic protist and are the most important primary producer in aquatic environments. Heat shock proteins (HSPs) are remarkably evolutionary conserved molecular chaperones and are present in all the prokaryotic and eukaryotic organisms. They are distributed into small HSP, HSP60, HSP70, HSP90, and HSP100, depending on their molecular weight and sequence similarity [12]. We determined full length sequences of HSP90 and HSP70 of the dinoflagellate C. polykrikoides and characterized their gene and genomic features. These included analysis of genomic DNA, deduced protein sequences, phylogenetic relationships, and their gene regulation under metal and nonmetal stress conditions as well

Materials and Methods

B26 B25 CpHSP70-DF1 CpHSP70-DR1 CpHSP90-DF1 CpHSP90-DR1 CpHSP70-IF1 CpHSP70-IR1

Results and Discussion

76 AAAGAGATCTTCCTCCGAGAGTTGATCAGCAACGCATCCGATGCATTGGACAAGATCAGGTACGAGTCCATCACC

96 Amphidinium mootonorum ADP65793

99 Cryptosporidium suis ABJ09793 100 Cryptosporidium meleagridis AAM33485