Abstract
Invariant chain (Ii) serves as a chaperone for folding and intracellular transport of major histocompatibility complex class II (MHCII) molecules. Early in biosynthesis, Ii associates with MHCII molecules and directs their intracellular transport to endocytic compartments where vesicular proteinases sequentially release Ii from the MHCII heterodimer. The detachment of Ii makes the MHCII groove susceptible for binding of antigenic peptides. We investigated the role of N-linked glycosylation in the controlled intracellular degradation of Ii. Motifs for asparagine-linked glycosylation were altered, and mutated Ii (IiNmut) was transiently expressed in COS cells. The half-life of IiNmut was strongly reduced compared with wild-type Ii although the sensitivity of the N glycan-free polypeptide to in vitro proteinase digestion was not substantially increased. Inhibition of vesicular proteinases revealed endosomal degradation of IiNmut. Intracellular proteolysis of IiNmut is substantially impaired by serine proteinase inhibitors. Thus, a considerable amount of IiNmut is degraded in nonacidic intracellular compartments. The data suggest that N-linked glycosylation of Ii hinders premature proteolysis in nonacidic vesicles resulting in Ii degradation in acidic MHC class II-processing compartments.
Highlights
Trimer of invariant chain (Ii) contains a cytoplasmic sorting signal that directs transport of the major histocompatibility complex class II (MHCII)/Ii complex from the secretory pathway to the endocytic route [7, 8]
The data suggest that N-linked glycosylation of Ii hinders premature proteolysis in nonacidic vesicles resulting in Ii degradation in acidic MHC class II-processing compartments
C-terminal to the second carbohydrate adjoins a trimerization domain of Ii that is essential for assembly of the functional nonameric MHCII/Ii complex
Summary
Biochemicals and Antibodies—In 1 is a rat mAb directed against the N terminus of murine Ii [24]. A phosphorylated oligonucleotide (AAGAACGTTAACAAGTACGGCAGCATGACCCAG) containing the mutation of the two N-linked glycosylation sites of Ii was hybridized to the Ii plasmid (Ii cDNA cloned into the polylinker region of pUC18). This oligonucleotide contains an unique HpaI site. The protein A-bound material was washed several times with 0.25% Nonidet P-40/TBS containing proteinase inhibitors and was subsequently analyzed by SDS-PAGE. Concanamycin B (stock in ethanol), Pefabloc (stock in phosphate-buffered saline), and TLCK (stock in 0.05 M 3-morpholino-ethansulfonic acid, pH 5.5) were present 12 h before labeling at concentrations of 20 nM, 0.5 mM, and 100 M. The inhibitors E64d and pepstatin A were dissolved in Me2SO (final concentration 200 M and 1 g/ml) and added 12 h before labeling to COS7 cells. All inhibitors were present during labeling and pulse-chase periods
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
