Global analysis of gene expression profiles in the submandibular salivary gland of klotho knockout mice.

Sung‐Min Kwon,Soo‐A Kim,Sang‐Gun Ahn,Jong‐In Yook,Jung‐Hoon Yoon

doi:10.1002/jcp.26172

Abstract

Salivary dysfunction commonly occurs in many older adults and is considered a physiological phenomenon. However, the genetic changes in salivary glands during aging have not been characterized. The present study analyzed the gene expression profile in salivary glands from accelerated aging klotho deficient mice (klotho−/−, 4 weeks old). Microarray analysis showed that 195 genes were differentially expressed (z‐score > 2 in two independent arrays) in klotho null mice compared to wild‐type mice. Importantly, alpha2‐Na+/K+‐ATPase (Atp1a2), Ca2+‐ATPase (Atp2a1), epidermal growth factor (EGF), and nerve growth factor (NGF), which have been suggested to be regulators of submandibular salivary gland function, were significantly decreased. When a network was constructed from the differentially expressed genes, proliferator‐activated receptor‐γ (PPAR γ), which regulates energy homeostasis and insulin sensitivity, was located at the core of the network. In addition, the expression of genes proposed to regulate various PPAR γ‐related cellular pathways, such as Klk1b26, Egfbp2, Cox8b, Gpx3, Fabp3, EGF, and NGFβ, was altered in the submandibular salivary glands of klotho−/− mice. Our results may provide clues for the identification of novel genes involved in salivary gland dysfunction. Further characterization of these differentially expressed genes will be useful in elucidating the genetic basis of aging‐related changes in the submandibular salivary gland.

Highlights

Salivary glands are involved in the secretion of saliva, which participates in the protection and hydration of mucosal structures within the oral cavity, oropharynx, and esophagus, the maintenance of tooth integrity, antimicrobial defense, and protection from chemical and mechanical stress (Atkinson & Wu, 1994; Mandel, 1989)
To further investigate the biological function classifications of the genes related to submandibular salivary gland dysfunction in klothodeficient mice, we performed GO analysis of all sets of genes regulated in klotho WT versus klotho−/− mice
BADGE did not affect CIDEA expression in klotho overexpressed Human submandibular gland cells (HSG) cells. These results indicated that use of a PPARG antagonist partly affected the mechanisms of klotho-mediated fatty acid and/or water channel

Summary

| INTRODUCTION

Salivary glands are involved in the secretion of saliva, which participates in the protection and hydration of mucosal structures within the oral cavity, oropharynx, and esophagus, the maintenance of tooth integrity, antimicrobial defense, and protection from chemical and mechanical stress (Atkinson & Wu, 1994; Mandel, 1989). Histological observations have shown that the numbers of NGF- and EGF-immunopositive ducts in the submandibular salivary gland are decreased in klotho-deficient mice compared to wild-type mice (Suzuki et al, 2006). These gene depletion studies have not provided insights on the regulation of salivary gland function during aging. The data provided a network for investigating PARP-γ transcriptional programs in the submandibular salivary gland in klotho-related aging These differentially expressed genes will contribute to an understanding of the genetic basis of klotho and the elucidation of the mechanism of biological behavior in the submandibular salivary gland

| MATERIALS AND METHODS

F: AGTCACTCGGTGTGGGCTTTGCCA

| RESULTS

Findings

| DISCUSSION