GLI transcriptional repression regulates tissue-specific enhancer activity in response to Hedgehog signaling.

Rachel K Lex,Hongkai Ji,Kristin N Falkenstein,Weiqiang Zhou,Steven A Vokes,Zhicheng Ji,Joanna L Henry

doi:10.7554/elife.50670

Rachel K Lex, Hongkai Ji + Show 5 more

Open Access

https://doi.org/10.7554/elife.50670

Copy DOI

Journal: eLife	Publication Date: Jan 28, 2020
Citations: 33	License type: CC BY 4.0

Affiliation: The University of Texas at Austin, Johns Hopkins University

Abstract

Transcriptional repression needs to be rapidly reversible during embryonic development. This extends to the Hedgehog pathway, which primarily serves to counter GLI repression by processing GLI proteins into transcriptional activators. In investigating the mechanisms underlying GLI repression, we find that a subset of GLI binding regions, termed HH-responsive enhancers, specifically loses acetylation in the absence of HH signaling. These regions are highly enriched around HH target genes and primarily drive HH-specific transcriptional activity in the mouse limb bud. They also retain H3K27ac enrichment in limb buds devoid of GLI activator and repressor, indicating that their activity is primarily regulated by GLI repression. Furthermore, the Polycomb repression complex is not active at most of these regions, suggesting it is not a major mechanism of GLI repression. We propose a model for tissue-specific enhancer activity in which an HDAC-associated GLI repression complex regulates target genes by altering the acetylation status at enhancers.

Highlights

Transcriptional repressors are instrumental in establishing developmental lineages and preventing improper gene expression
A subset of GLI binding regions is epigenetically regulated by HH signaling Since most HH targets can be activated by loss of GLI repression, we hypothesized that enhancers may be activated by HH signaling when GLI repression is relieved
We identified 7,282 endogenous GLI3 binding regions (GBRs), with the majority of regions enriched for H3K27ac (83%; 6,064/7,282 GLI binding regions (GBRs)) in wild-type (WT) limb buds which have active HH signaling (Figure 1—figure supplement 1A; Figure 1—source data 1)

Summary

Introduction

Transcriptional repressors are instrumental in establishing developmental lineages and preventing improper gene expression. GLI activators are enriched in the posterior limb bud where many cells are exposed to HH ligands, while an inverse domain of GLI repressors in the anterior limb bud serve to spatially restrict the boundary of HH target gene expression (Wang et al, 2000; Ahn and Joyner, 2004) The presence of both GLI activator and GLI repressor domains makes the limb bud an ideal model for understanding the roles of GLI proteins in regulating HH-responsive transcription. The mechanisms underlying GLI repression are unknown but could in principle function either by excluding GLI activator binding or by recruiting co-repressors (Wang et al, 2010) The former category provides an attractive model for how GLI proteins might interpret gradients of HH ligand (Falkenstein and Vokes, 2014), it fails to account for the large number of GLI target genes that are fully activated upon de-repression in the absence of HH signaling, and likewise, GLI activator. We propose that GLI repressors inhibit gene expression by altering enhancer activity, providing an explanation for the labile nature of GLI repression

Results

Discussion

Materials and methods

F: AGCTAACAGCCTGCCCTCTG R