Genome-sequence analysis of Acinetobacter johnsonii MB44 reveals potential nematode-virulent factors.

Shijing Tian,Lin Li,Li Xie,Muhammad Ali

doi:10.1186/s40064-016-2668-5

Abstract

Acinetobacter johnsonii is generally recognized as a nonpathogenic bacterium although it is often found in hospital environments. However, a newly identified isolate of this species from a frost-plant-tissue sample, namely, A. johnsonii MB44, showed significant nematicidal activity against the model organism Caenorhabditis elegans. To expand our understanding of this bacterial species, we generated a draft genome sequence of MB44 and analyzed its genomic features related to nematicidal attributes. The 3.36 Mb long genome contains 3636 predicted protein-coding genes and 95 RNA genes (including 14 rRNA genes), with a G + C content of 41.37 %. Genomic analysis of the prediction of nematicidal proteins using the software MP3 revealed a total of 108 potential virulence proteins. Some of these proteins were homologous to the known virulent proteins identified from Acinetobacter baumannii, a pathogenic species of the genus Acinetobacter. These virulent proteins included the outer membrane protein A, the phospholipase D, and penicillin-binding protein 7/8. Moreover, one siderophore biosynthesis gene cluster and one capsular polysaccharide gene cluster, which were predicted to be important virulence factors for C. elegans, were identified in the MB44 genome. The current study demonstrated that A. johnsonii MB44, with its nematicidal activity, could be an opportunistic pathogen to animals.Electronic supplementary materialThe online version of this article (doi:10.1186/s40064-016-2668-5) contains supplementary material, which is available to authorized users.

Highlights

Bacterial species of the genus Acinetobacter are ubiquitous in nature and are usually found in the hospital environment; some of these species have been implicated in a variety of nosocomial infections (Bergogne-Berezin and Towner 1996)
Prior to whole-genome sequencing, a 1434 bp 16S rRNA gene sequence was amplified by PCR using 27F (AGAGTTTGATCCTGGCTCAG) and 1492R (GGTTACCTTGTTACGACTT) sequenced
In this study, we presented a whole-genome analysis of A. johnsonii MB44 to identify its potential virulence factors against C. elegans

Summary

Introduction

Bacterial species of the genus Acinetobacter are ubiquitous in nature and are usually found in the hospital environment; some of these species have been implicated in a variety of nosocomial infections (Bergogne-Berezin and Towner 1996). Acinetobacter baumannii is known as a global nosocomial pathogen for its ability to cause hospital outbreaks and develop antibiotic resistance (Dijkshoorn et al 2007; Peleg et al 2008); A. pittii and A. nosocomialis have been reported to be associated with human infections (Chuang et al 2011; Wang et al 2013). Certain Acinetobacter species are currently emphasized in discussions on pathogenicity and mechanisms of multidrug resistance. The human-pathogen A. baumannii and A. nosocomialis have been reported for their pathogenicity against C. elegans (Vila-Farres et al 2015; Smith et al 2004). To identify the potential virulence factors and better understand the molecular mechanism of its ability to infect nematodes, we performed genome sequencing of A. johnsonii MB44. The genomic features and the potential nematode-virulent genes were reported

Methods

Results

Conclusion