Abstract
The major histocompatibility complex (MHC) plays well-defined roles in eliciting immune responses and combating infectious diseases. The major histocompatibility complex of cattle is referred to as BoLA (Bovine Lymphocyte Antigen). This genetic system is among the most polymorphic. In the present study, polymorphism of the BoLA- DRB3.2 locus in three Bos indicus breeds viz., Sahiwal, Rathi and Hariana was studied by polymerase chain reaction restriction fragment length polymorphism technique using the enzymes RsaI, Bst Y1 and Hae III. Both Sahiwal and Rathi are good Indian dairy breeds and survive under tough tropical conditions, while Hariana is a prominent dual-purpose breed reared both as a dairy animal and for bullock production. A total of 30 different BoLA-DRB3.2 alleles were observed to be present in the 3 Bos indicus breeds. Certain alleles were common amongst the three breeds while there were others that were unique to each breed. Allelic distribution amongst the three breeds showed that each breed had a unique allelic distribution pattern that was different from each other and also different from the earlier breeds studied so far for the existence of allelic variation at this locus. A dendogram was constructed based on the frequencies of the BoLA-DRB3 alleles using the UPGMA method. The Rathi and Hariana animals were genetically the most apart. The Hariana animals clustered on a different branch from the other two breeds viz. the Rathi and the Sahiwal. The smallest genetic distances for the DRB3 alleles were those between Sahiwal and Rathi (0.5461) while genetic distance between Hariana and Sahiwal was 0.6123. A comparison of the allelic frequencies of the BoLA-DRB3.2 locus in these 3 breeds viz. Sahiwal, Hariana and Rathi with the allelic frequencies present in the previously characterized Bos indicus Kankrej breed, which is a dual purpose breed reared both as a draught and a dairy animal, showed that the Bos indicus Sahiwal and Rathi breeds clustered into one group while the Hariana and Kankrej breeds formed another group. The Rathi and Sahiwal showed the least genetic distance of 0.5461 amongst the breeds whereas the Rathi and Kankrej, with a Nei's genetic distance of 1.1622, were genetically the most distant apart.
Highlights
The major histocompatibility complex (MHC) is a fundamental part of the immune system in most vertebrates (Edwards and Hedrick, 1998)
Amplification of bovine lymphocyte antigen (BoLA)-DRB3 exon 2 BoLA DRB3.2 gene was amplified by the polymerase chain reaction (PCR) by using the oligonucleotide primers viz., LA31, 5’- GATGGATCCTCTCTCTGCAGCACA TTTCCT-3’ and LA32, 5’-CTTGAATTCGCGCTCACCT CGCCGCTG-3’, as described by Sigurdardottir et al (1991) for the PCR amplification of the DRB3 exon 2 in cattle
Using the specified primer pair (Sigurdardottir et al, 1991), a PCR product of size approx. 304 bp of the BoLADRB 3.2 gene was obtained for all 3 breeds used for the study
Summary
The major histocompatibility complex (MHC) is a fundamental part of the immune system in most vertebrates (Edwards and Hedrick, 1998). The major histocompatibility complex in cattle is constituted by the bovine lymphocyte antigen (BoLA) system. The class II genes of BoLA are located within two distinct regions of chromosome 23. Class IIa region contains the functionally expressed DR and DQ genes. The BoLA-DR region is composed of one DRA locus and at least three DRB loci, DRB1, 2 and 3. The BoLA-DRB3 locus is expressed at high levels while DRB1 is expressed at a low level; DRB2 is a pseudogene (Burke et al, 1991). BoLA DRB3.2, which is the second exon of the third DRB bovine gene, is
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
