Abstract
Infection with hepatitis C virus (HCV) imposes a global challenge with over 180 million cases worldwide. Only few patients spontaneously had their virus neutralized, while most patients develop chronic HCV infection. This implies a key role of genetic factors in viral clearance or persistence. The current study aimed at clarifying the effect of certain single nucleotide polymorphisms (SNPs) on individual's susceptibility to HCV infection. A total of 60 patients with confirmed HCV infection and 35 apparently healthy individuals were enrolled in this study. Blood sample was obtained from each participant, from which DNA was extracted. The JAK1gene was amplified with conventional PCR technique using three sets of primers targeting three SNPs in this gene: rs2780895, rs4244165 and rs17127024. Restriction fragment length polymorphism (RFLP) was used for genotyping of PCR products. Each of rs2780895 and rs17127024 had two genotypes in both patients and controls, however, only the heterozygous genotype of the SNP rs2780895 (CT) significantly associated with the susceptibility to HCV. The SNP rs4244165 appeared in only with homozygous wild genotype (GG) in both patients and controls. It can be concluded that allele T of the SNP rs2780895 could be considered as a risk factor for infection with HCV
Highlights
الٌوط الدٌٖ٘ الوخغاٗز للخباٗي,hepatitis C virus (HCV), JAK1 خ٘ي:الكلواث الوفخاح٘ت Introduction Hepatitis C virus is one of the leading causes of morbidity and mortality due to viral infection [1]
Single nucleotide polymorphisms in different genes were found to affect the susceptibility to HCV infection
We hypothesized that some SNPs in this gene can influence the susceptibility to HCV and we conducted this study which aimed to clarify the effect of certain single nucleotide polymorphisms (SNPs) on individual's susceptibility to HCV infection
Summary
Genetic Variants in JAK1 Gene and Susceptibility to Hepatitis C Viral Infection in Iraq. More recent evidence [8] revealed that certain SNPs in this gene were associated with the outcomes of HBV infection. We hypothesized that some SNPs in this gene can influence the susceptibility to HCV and we conducted this study which aimed to clarify the effect of certain single nucleotide polymorphisms (SNPs) on individual's susceptibility to HCV infection. Criteria of enrolling were patients with positive HCV antibodies by enzyme linked immunosorbent assay (ELISA) or HCV RNA by reverse transcriptase polymerase chain reaction (RTPCR). Another 35 apparently age-matched individuals from those who were attending the same city for routine medical check were recruited as a control group. Primer sequence (5'-3') F: CACAGGTAGATTTGGAGGAG R: AAGACGCTGATTGAGGTGAG F: GTGACTGCATAGTGGAGGTG R: CTTTAGAAGCCCCTATTGCC F: GTGAGCAGGTGGAGAGAATC R: TACTGGCACAAAGCAGGACC
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have