Abstract
Internally located, cis-acting RNA replication elements, termed cres, are essential for replication of the genomes of picornaviruses such as human rhinovirus 14 (HRV-14) and poliovirus because they template uridylylation of the protein primer, VPg, by the polymerase 3D(pol). These cres form stem-loop structures sharing a common loop motif, and the HRV-14 cre can substitute functionally for the poliovirus cre in both uridylylation in vitro and RNA replication in vivo. We show, however, that the poliovirus cre is unable to support HRV-14 RNA replication. This lack of complementation maps to the stem of the poliovirus cre and was reversed by single nucleotide substitutions in the stem as well as the base of the loop. Replication-competent, revertant viruses rescued from dicistronic HRV-14 RNAs containing the poliovirus cre, or a chimeric cre containing the poliovirus stem, contained adaptive amino acid substitutions. These mapped to the surface of both the polymerase 3D(pol), at the tip of the "thumb" domain, and the protease 3C(pro), on the side opposing the active site and near the end of an extended strand segment implicated previously in RNA binding. These mutations substantially enhanced replication competence when introduced into HRV-14 RNAs containing the poliovirus cre, and they were additive in their effects. The data support a model in which 3CD or its derivatives 3C(pro) and 3D(pol) interact directly with the stem of the cre during uridylylation of VPg.
Highlights
The picornaviruses comprise a large and relatively diverse family of viruses that includes many animal and human pathogens [1]
It appears to interact with a second cellular protein, poly(A)-binding protein, which binds to the poly(A) sequence at the 3Ј-end of the genome, forming a protein bridge leading to circularization of the genome and mediating the initiation of negative-strand RNA synthesis [11]
These results suggest that the cre RNA interacts directly with the 3Cpro protease and 3Dpol polymerase, or the 3CD precursor protein, and indicate that this interaction is vital for viral RNA replication
Summary
Construction of Plasmids—The plasmids p⌬P1Luc-PVcre, ⌬P1LucPVstm and ⌬P1Luc-PVlp were constructed by ligating oligonucleotides representing the PV cre or HRV-14/PV chimeric cre sequences into p⌬P1Luc-⌬cre [21] after it had been digested with XhoI and NheI restriction endonucleases (Fig. 1). The native cre sequence located within the VP1 coding region was mutated by QuikChange site-directed mutagenesis (Stratagene) using the following oligonucleotides: (ϩ), GCACTCACTGAAGGTTTGGGAGACGAGTTGGAGGAGGTTATTGTCGAAAAGACTAAGCAAACCGTTGCGTCCATATCCTCAGGTCCAAAACACACAC; and (Ϫ), GTGTGTG-. In Vitro RNA Transcription—To produce replicon or dicistronic viral RNA transcripts, plasmids were linearized at the unique MluI restriction site downstream of the 3Ј-viral poly(A) sequence. Rescue and Analysis of Revertant Viruses—HeLa cells were transfected with 5 g of dicistronic RNA transcript using a GenePulser II electroporation apparatus (Bio-Rad) as described previously [20]. Replicon RNA Amplification Assays—HeLa cells were transfected with replicon RNA transcripts as described previously [36], seeded into 6-well plates, and cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum at 34 °C. Cell lysates were harvested by the addition of 125 ml of passive lysis buffer (Promega) to each well and stored at Ϫ70 °C until assayed for enzymatic activity. Molecular Display and Modeling—Protein structures were displayed and modeled using Swiss-PDB Viewer [37]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
