Abstract
BackgroundA major concern in malaria vaccine development is genetic polymorphisms typically observed among Plasmodium isolates in different geographical areas across the world. Highly polymorphic regions have been observed in Plasmodium falciparum and Plasmodium vivax antigenic surface proteins such as Circumsporozoite protein (CSP), Duffy-binding protein (DBP), Merozoite surface protein-1 (MSP-1), Apical membrane antigen-1 (AMA-1) and Thrombospondin related anonymous protein (TRAP).MethodsGenetic variability was assessed in important polymorphic regions of various vaccine candidate antigens in P. vivax among 106 isolates from the Amazon Region of Loreto, Peru. In addition, genetic diversity determined in Peruvian isolates was compared to population studies from various geographical locations worldwide.ResultsThe structured diversity found in P. vivax populations did not show a geographic pattern and haplotypes from all gene candidates were distributed worldwide. In addition, evidence of balancing selection was found in polymorphic regions of the trap, dbp and ama-1 genes.ConclusionsIt is important to have a good representation of the haplotypes circulating worldwide when implementing a vaccine, regardless of the geographic region of deployment since selective pressure plays an important role in structuring antigen diversity.
Highlights
A major concern in malaria vaccine development is genetic polymorphisms typically observed among Plasmodium isolates in different geographical areas across the world
It is important to have a good representation of the haplotypes circulating worldwide when implementing a vaccine, regardless of the geographic region of deployment since selective pressure plays an important role in structuring antigen diversity
2008, 560,221 malaria cases were reported in the Americas [5]; 74.2% of them caused by P. vivax and 25.7% by
Summary
The PCR conditions were: min at 94°C; 1 min at 94°C, 1 min at 58°C, 2 min at 72°C for 35 cycles; and a final extension of 72°C for 2 min, using the primers VSC-OF (5’ATGTAGATCTGTCCAAGGCCATAAA3’) and VSC-OR To test whether the haplotypes clustered according to their geographic origin, the model-based clustering algorithm implemented in the Structure 2.1 software was used [48] This software uses a Bayesian clustering approach to assign isolates to K populations characterized by a set of allele frequencies at each locus. The genetic difference between clusters was measured by the fixation index (Fst) calculated from the haplotype frequencies (Hst) and pair-wise DNA sequence diversity (Kst*) using DnaSP version 5.0 [46]. Snn is expected to be near one when the populations at the two localities are highly differentiated and near one-half when the populations at the two localities are part of the same pan-mictic population [51]
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
