Abstract
BackgroundAntibody phage display is a proven key technology that allows the generation of human antibodies for diagnostics and therapy. From naive antibody gene libraries - in theory - antibodies against any target can be selected. Here we describe the design, construction and characterization of an optimized antibody phage display library.ResultsThe naive antibody gene libraries HAL9 and HAL10, with a combined theoretical diversity of 1.5×1010 independent clones, were constructed from 98 healthy donors using improved phage display vectors. In detail, most common phagemids employed for antibody phage display are using a combined His/Myc tag for detection and purification. We show that changing the tag order to Myc/His improved the production of soluble antibodies, but did not affect antibody phage display. For several published antibody libraries, the selected number of kappa scFvs were lower compared to lambda scFvs, probably due to a lower kappa scFv or Fab expression rate. Deletion of a phenylalanine at the end of the CL linker sequence in our new phagemid design increased scFv production rate and frequency of selected kappa antibodies significantly. The HAL libraries and 834 antibodies selected against 121 targets were analyzed regarding the used germline V-genes, used V-gene combinations and CDR-H3/-L3 length and composition. The amino acid diversity and distribution in the CDR-H3 of the initial library was retrieved in the CDR-H3 of selected antibodies showing that all CDR-H3 amino acids occurring in the human antibody repertoire can be functionally used and is not biased by E. coli expression or phage selection. Further, the data underline the importance of CDR length variations.ConclusionThe highly diverse universal antibody gene libraries HAL9/10 were constructed using an optimized scFv phagemid vector design. Analysis of selected antibodies revealed that the complete amino acid diversity in the CDR-H3 was also found in selected scFvs showing the functionality of the naive CDR-H3 diversity.
Highlights
Antibody phage display is a proven key technology that allows the generation of human antibodies for diagnostics and therapy
Construction of phage display vectors The phage display vector pHAL30 was constructed by cloning a DNA fragment encoding His-/C-Myc tag flanked by NotI and BamHI, which was generated with two PCR primers (MHMycHIS-NotI_f:5′ CGCGTGCGGCCGCAG GTTCTGAACAAAAGCTGATCTC 3′; MHMycHisBam Hi_r: 5′ CGCGTGGATCCCTAATGATGATGGTGATGA TGGG 3′) into pHAL14
Functional soluble scFv antibody fragments were quantified by antigen ELISA in the production supernatant, the periplasmatic extract, the osmotic shock fraction and the eluate after IMAC purification (Figure 2A)
Summary
Antibody phage display is a proven key technology that allows the generation of human antibodies for diagnostics and therapy. Results: The naive antibody gene libraries HAL9 and HAL10, with a combined theoretical diversity of 1.5×1010 independent clones, were constructed from 98 healthy donors using improved phage display vectors. Kügler et al BMC Biotechnology (2015) 15:10 alternative or complementing technology to generate human antibody fragments from universal antibody gene libraries as lead candidates for therapeutic development [17,20,21,22]. To isolate human antibodies by phage display, two types of antibody gene libraries are used: immune libraries and universal or “single-pot” libraries [24,25]. “Single-pot” libraries allow the selection of antibodies - in theory - against any target. Due to its quicker and easier production, it provides a robust format for screening of large numbers of antibody candidates, and can be converted to full IgG afterwards
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
