Abstract
We have isolated and analyzed the structure of the gene grik5 (glutamate receptor ionotropic kainate 5), encoding the rat kainate receptor subunit KA2. Six overlapping DNA fragments containing the entire grik5 gene were identified in a rat genomic library. grik5 is a unique gene composed of 20 exons that together span over 54 kilobases (kb). Reporter gene analysis demonstrated that 2 kb of grik5 5'-flanking sequence confers tissue-specific expression on a chloramphenicol acetyltransferase gene in vitro. We show that (i) the first intron of grik5 (3.4 kb) inhibited transcription of the chloramphenicol acetyltransferase gene driven by the 2-kb grik5 5'-flanking region; (ii) the negative regulatory element was located within 500 bp of the 3'-end of intron 1, and this 500-bp fragment selectively bound nuclear proteins isolated from neural and nonneural cells; (iii) the effect of the negative regulatory element on grik5 transcription was orientation- and distance-independent; and (iv) a 24-nucleotide sequence (CTTTCTGTGGCCTCTGACCTTTCC) was identified as the binding site for nuclear proteins within the 500-bp fragment, as determined by footprinting and gel shift assays. We conclude that an intronic element that displays features of a silencer modulates grik5 transcription.
Highlights
The nucleotide sequence(s) reported in this paper has been submitted to the GenBankTM/EBI Data Bank with accession number(s) U81010
The kainate-preferring subunit KA2 [5] is encoded by the gene grik5, which has been mapped to chromosomes 1, 7, and 19 in rat, mouse, and human, respectively [6]
Analysis of the 5Ј-untranslated region revealed that grik5 is a TATA-less gene, whose transcription can initiate at several sites within a 500-bp region flanking the receptor subunit coding sequence [9]
Summary
GluR, glutamate receptor; kb, kilobase(s); bp, base pair(s); CAT, chloramphenicol acetyltransferase; RTPCR, reverse transcription-polymerase chain reaction; AMPA, (R,S)-␣amino-3-hydroxy-5-methyl-isoxazole-4-propionic acid. The kainate-preferring subunit KA2 [5] is encoded by the gene grik (glutamate receptor ionotropic kainate 5), which has been mapped to chromosomes 1, 7, and 19 in rat, mouse, and human, respectively [6]. Little is known about the function and physiological role of the KA2 subunit, or how the grik gene is regulated during brain development. Analysis of the 5Ј-untranslated region revealed that grik is a TATA-less gene, whose transcription can initiate at several sites within a 500-bp region flanking the receptor subunit coding sequence [9]. We have isolated the entire grik gene, determined its exon-intron organization, and identified a negative regulatory region within the first intron, which inhibits reporter gene expression driven by the 5Ј-flanking region of grik. The negative regulatory element within the first intron exerts its inhibitory effect in a distance- and orientationindependent manner and displays features of a silencer
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
