Functional Importance of the Amino Terminus of Gqα

John R Hepler,Gloria H Biddlecome,Christiane Kleuss,Laura A Camp,Sandra L Hofmann,Elliott M Ross,Alfred G Gilman

doi:10.1074/jbc.271.1.496

John R Hepler, Gloria H Biddlecome + Show 5 more

Open Access

https://doi.org/10.1074/jbc.271.1.496

Copy DOI

Abstract

Gq alpha is palmitoylated at residues Cys9 and Cys10. Removal of palmitate from purified Gq alpha with palmitoylthioesterase in vitro failed to alter interactions of Gq alpha with phospholipase C-beta 1, the G protein beta gamma subunit complex, or m1 muscarinic cholinergic receptors. Mutants C9A, C10A, C9A/C10A, C9S/C10S, and truncated Gq alpha (removal of residues 1-6) were synthesized in Sf9 cells and purified. Loss of both Cys residues or truncation prevented palmitoylation of Gq alpha. However, truncated Gq alpha and the single Cys mutants activated phospholipase C-beta 1 normally, while the double Cys mutants were poor activators. Loss of both Cys residues impaired but did not abolish interaction of Gq alpha with m1 receptors. These Cys residues are thus important regardless of their state of palmitoylation. When expressed in HEK-293 or Sf9 cells, all of the proteins studied associated entirely or predominantly with membranes, although a minor fraction of nonpalmitoylated Gq alpha proteins accumulated in the cytosol of HEK-293 cells. When subjected to TX-114 phase partitioning, a significant fraction of all of the proteins, including those with no palmitate, was found in the detergent-rich phase. Removal of residues 1-34 of Gq alpha caused a loss of surface hydrophobicity as evidenced by complete partitioning into the aqueous phase. The Cys residues at the amino terminus of Gq alpha are thus important for its interactions with effector and receptor, and the amino terminus conveys a hydrophobic character to the protein distinct from that contributed by palmitate.

Highlights

Heterotrimeric guanine nucleotide binding proteins (G proteins)1 link cell surface receptors with intracellular effectors [1,2,3]
We have investigated the importance of amino-terminal domains of G proteins using the m1 muscarinic cholinergic recep
When Sf9 cells are infected with baculovirus encoding Gq␣, Gs␣, or Gi␣1 along with viruses encoding ␤2 and ␥2 subunits, newly synthesized ␣ subunits accumulate in both membranes and cytosol; only the membrane-associated ␣ subunits incorporate [3H]palmitate (Fig. 1A)

Summary

EXPERIMENTAL PROCEDURES

Materials—[3H]Palmitoyl-Ha-ras [26] and purified recombinant palmitoylthioesterase were prepared as previously described [27]. The following complementary pair of oligonucleotides were synthesized to construct Gq␣CH6: 5ЈGCTGAACCTGAAGGAGTACAATCTGGTCAGGCATCACCATCACCATCACTAATA and 3Ј-ACGTCGACTTGGACTTCCTCATGTTAGACCAAGGTCCGTTGGTAGTGGTAGTGATTATTCGA This cassette encodes the extreme carboxyl terminus of Gq␣, the hexahistadine tag, and a stop codon, and it contains PstI and HindIII sites at its 5Ј and 3Ј ends, respectively. The column was washed with 5 column volumes of buffer F (50 mM NaHepes, pH 7.4, 1 mM EDTA, 3 mM EGTA, 5 mM MgCl2, 2 mM dithiothreitol, 0.1 mM GDP), and protein was eluted with a 40-ml linear gradient of NaCl (0 –1 M) in buffer F. Receptor-Gq vesicles were mixed with 1 ␮M [␥-32P]GTP and either 1 mM carbachol or 10 ␮M atropine in a volume of 50 ␮l (final buffer: 20 mM NaHepes [pH 8.0], 100 mM NaCl, 1.1 mM EDTA, 0.2 mM EGTA, 3.9 mM total MgCl2, and 0.26 mg/ml BSA). Fatty acids removed from Gq␣ by hydrolysis were analyzed by HPLC [10]

RESULTS

DISCUSSION

GTP hydrolysisa