Functional FCGR2B gene variants influence intravenous immunoglobulin response in patients with Kawasaki disease

Abstract

To the Editor:Human intravenous immunoglobulin (IVIG) administered at a high dose suppresses inflammation caused by several autoimmune diseases. Although IVIG is licensed for the treatment of patients with Kawasaki disease (KD), idiopathic thrombocytic purpura, Guillan-Barré syndrome, and chronic inflammatory demyelinating polyneuropathy, the modes of action in these clinical syndromes require elucidation. Proposed mechanisms include F(ab′)2-dependent modulation of pathogenic autoantibody neutralization, cytokine production, and complement component neutralization.1Negi V.S. Elluru S. Siberil S. Graff-Dubois S. Mouthon L. Kazatchkine M.D. et al.Intravenous immunoglobulin: an update on the clinical use and mechanisms of action.J Clin Immunol. 2007; 27: 233-245Crossref PubMed Scopus (204) Google Scholar However, studies with clinical and murine models show that IVIG anti-inflammatory potency depends more on the IgG Fc binding to receptors expressed on the surface of various immune cells. The Fcγ receptor (FcγR) family contains multiple activating receptors and a single inhibitory receptor, FcγRIIB. Importantly, B cells express only the inhibitory type. Presumably, IVIG modulates the balance between activating and inhibitory receptors.FcγRIIB plays a central role in mediating Fc-dependent anti-inflammatory actions in mice.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar IVIG elicits a minimal therapeutic effect in FcγRIIB-deficient mice with autoimmune disease3Samuelsson A. Towers T.L. Ravetch J.V. Anti-inflammatory activity of IVIG mediated through the inhibitory Fc receptor.Science. 2001; 291: 484-486Crossref PubMed Scopus (880) Google Scholar but induces FcγRIIB surface expression on splenic macrophages in wild-type mice,4Kaneko Y. Nimmerjahn F. Madaio M.P. Ravetch J.V. Pathology and protection in nephrotoxic nephritis is determined by selective engagement of specific Fc receptors.J Exp Med. 2006; 203: 789-797Crossref PubMed Scopus (206) Google Scholar thereby preventing antibody-induced inflammation. Also, IVIG upregulates FcγRIIB expression by monocytes and B cells among clinically responding patients with chronic inflammatory demyelinating polyneuropathy.5Tackenberg B. Jelcic I. Baerenwaldt A. Oertel W.H. Sommer N. Nimmerjahn F. et al.Impaired inhibitory Fcgamma receptor IIB expression on B cells in chronic inflammatory demyelinating polyneuropathy.Proc Natl Acad Sci U S A. 2009; 106: 4788-4792Crossref PubMed Scopus (193) Google Scholar Although these studies in mice and the limited patient data support a model for FcγRIIB involvement in IVIG actions, further clinical confirmation is required.We thus tested our hypothesis that the gene encoding FcγRIIB participates in IVIG anti-inflammatory action in human subjects by determining whether functionally relevant polymorphisms for this gene influence IVIG response in a KD cohort. This autoimmune syndrome produces acute and diffuse vasculitis. There is predilection for the coronary arteries, in which aneurysms occur in 20% to 25% of untreated patients. IVIG (2 g/kg) with aspirin represents the only standard therapy recommended for acute KD, but the response is variable. The American Heart Association and American Academy of Pediatrics define failure to respond or IVIG refractoriness to treatment as persistent or recurrent fever (temperature >38°C) at greater than 36 hours after completing the initial IVIG infusion.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar The IVIG refractory rate, depending on the clinical series, is reported to be between 13% to 30%.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar Coronary artery vasculitis and aneurysms occur at comparatively high rates in refractory patients.7Tremoulet A.H. Best B.M. Song S. Wang S. Corinaldesi E. Eichenfield J.R. et al.Resistance to intravenous immunoglobulin in children with Kawasaki disease.J Pediatr. 2008; 153: 117-121Abstract Full Text Full Text PDF PubMed Scopus (294) Google ScholarWith institutional review board approval and parental consent, we obtained DNA from patients with KD (n = 383) and parents (n = 578) from 3 centers in the Pacific Northwest. Qualifying patients met strict American Heart Association/American Academy of Pediatrics clinical criteria for the diagnosis of KD.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar The predominantly male cohort (59%) showed median KD age of onset at 34.5 months (interquartile range, 15-61.5 months). In our IVIG response analysis, we only included the patients with KD (231 responders, 76 refractory) if they received standard treatment within 10 days, followed guidelines prescribing IVIG refractoriness,6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar and were not participating in other treatment-related clinical trials. In all patients with KD and their parents (for frequency comparisons), we pyrosequenced (see the Methods section in this article’s Online Repository at www.jacionline.org) the DNA regions containing 3 known functional polymorphisms in the FCGR2B gene: a single nucleotide polymorphism in the FCGR2B region encoding either isoleucine (I) or threonine (T) amino acid at position 232 within the transmembrane region (nucleotide position +775; IIB+775 [T/c]), which is known to alter the function of this receptor, and 2 single nucleotide polymorphisms at positions −386 (IIB-386 [G/c]) and −120 (IIB-120 [T/a]) upstream from the translation start site known to alter the promoter activity, resulting in differing levels of receptor expression.8Li S. Ptacek T.S. Brown E.E. Edberg J.C. FcG receptors: structure, function and role as genetic risk factors in SLE.Genes Immun. 2009; 10: 380-389Crossref PubMed Scopus (98) Google Scholar We assigned race to subjects from this heterogeneous US population using 155 ancestry informative markers (AIMs) specific for Asian, African, Native American, and European descent (see the Methods section in this article’s Online Repository for more information).However, the allele frequency for all 3 polymorphisms differed substantially among the major racial and ethnic groups. Most strikingly, the A allele at FCGR2B-120T/a was totally absent in Asian patients (n = 48) and their unaffected parents (n = 86) and African American patients (n = 10) and their parents (n = 16); it was rare in Hispanic patients (n = 40) and their parents (n = 67). Thus we analyzed the effect of the polymorphisms on IVIG treatment response for each race, including the heterogeneous Hispanic population, separately. In Caucasian subjects the minor allele A at FCGR2B−120T/a occurred more frequently among the responders (15%) than the nonresponders (5%), with an odds ratio of 3.23 (95% CI, 1.22-8.33; P = .01; Table I). The overall genotypic distribution was different in responders and nonresponders (P = .03). Furthermore, no IVIG nonresponders were AA homozygous, whereas 5 (4%) of 128 responders were homozygotes, and a similar trend was observed with heterozygotes, occurring more frequently (23% vs 11%) among the responders (Fig 1). The Armitage trend test suggested a higher likelihood of being a responder with increased numbers of A alleles (P = .02). Only 2 Hispanic patients with KD were heterozygotes (AT); both were also IVIG responders. Consistent with a previous report on FCGR2B-386 (G/c) and FCGR2B-120 (T/a) haplotypes,9Su K. Li X. Edberg J.C. Wu J. Ferguson P. Kimberly R.P. A promoter haplotype of the immunoreceptor tyrosine-based inhibitory motif-bearing FcgammaRIIb alters receptor expression and associates with autoimmunity. II. Differential binding of GATA4 and Yin-Yang1 transcription factors and correlated receptor expression and function.J Immunol. 2004; 172: 7192-7199Crossref PubMed Scopus (93) Google Scholar the frequencies of G-T, C-A, and C-T haplotypes in Caucasian unaffected parents were 91%, 8%, and 1%, respectively. Among the patients, the distributions of these haplotypes differed significantly when comparing responders with nonresponders (84.5% vs 92%, 15% vs 6%, and 0.5% vs 2%, respectively; overall P = .02), with the increased C-A haplotype in the responders tagging FCGR2B-120A. In Asian subjects FCGR2B+775T/c, encoding the transmembrane region, showed trends related to IVIG treatment response, but the power was limited by the small sample size.Table IPolymorphisms in the FCGR2B gene and response to IVIG treatment among patients with KD in all ethnic groups and only Caucasian subjectsPolymorphismsMinor allele frequency (%)Allelic ORs (95% CI), responders vs nonrespondersP valueParentsRespondersNonrespondersAllelic∗χ2 Test (df = 1).Genotype†χ2 Test (df = 2).Trend‡Cochran-Armitage test.All ethnic groupsn = 578n = 231n = 76 FCGR2B+775T/c1518141.35 (0.79-2.22).28.42.34 FCGR2B−386G/c91071.61 (0.79-3.23).18.32.21 FCGR2B−120T/a91052.22 (0.98-5.02).05.17.06Caucasian subjectsn = 369n = 128n = 48 FCGR2B+775T/c1312130.97 (0.47-2.01).94.97.95 FCGR2B−386G/c131682.04 (0.91-4.55).08.21.10 FCGR2B−120T/a121553.23 (1.22-8.33).01.03.02Asian subjectsn = 86n = 40n = 8 FCGR2B+775T/c2740191.54 (0.39-6.25).11.15.14 FCGR2B−386G/c100———— FCGR2B−120T/a000————Hispanic subjectsn = 67n = 29n = 11 FCGR2B+775T/c—.49.65.51 FCGR2B−386G/c———— FCGR2B−120T/a————Boldfaced values are statistically significant.OR, Odds ratio.∗ χ2 Test (df = 1).† χ2 Test (df = 2).‡ Cochran-Armitage test. Open table in a new tab FcγRIIB inhibits immune response through coligation with either activating FcγRs or with B-cell receptors bound to immune complexes.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar This coligation leads to phosphorylation of the cytoplasmic immunoreceptor tyrosine-based inhibitory motif within the transmembrane FcγRIIB portion. Immunoreceptor tyrosine-based inhibitory motif phosphorylation leads to downstream target dephosphorylation and inhibition of the activating signaling cascade. Inhibition increases with increased FcγRIIB surface expression, which is controlled in part at the transcriptional level. Transfection of the FCGR2B−386/C and FCGR2B−120/A promoter haplotype into BJAB or U397 cells increases constitutive and cyclic AMP–stimulated FCGR2B promoter activity through enhanced binding to GATA4 and Yin-Yang1 (YY1) transcription factors.9Su K. Li X. Edberg J.C. Wu J. Ferguson P. Kimberly R.P. A promoter haplotype of the immunoreceptor tyrosine-based inhibitory motif-bearing FcgammaRIIb alters receptor expression and associates with autoimmunity. II. Differential binding of GATA4 and Yin-Yang1 transcription factors and correlated receptor expression and function.J Immunol. 2004; 172: 7192-7199Crossref PubMed Scopus (93) Google Scholar Accordingly, our data, which were obtained in human subjects and linking increased FCGR2B promoter activity with improved clinical response, confirm the importance of FcγRIIB in mediating the anti-inflammatory action of high-dose IVIG.The prevailing models derived primarily from murine experiments suggest that IVIG sensing occurs through 1 or multiple candidates, such as FcγRIII or DC-SIGN-related-1.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar FcγRIIB is downstream within a signaling cascade but is required to trigger IVIG-mediated inflammatory inhibition. Thus functional polymorphisms or other influences in 1 or multiple candidate genes along this cascade could also affect the IVIG response. The specificity of this promoter polymorphism for the Caucasian population suggests that these candidates or others, possibly involving the activating FcγRs, could be responsible for the IVIG response variation in subjects of other races. This study provides the basis for defining the IVIG regulatory mechanisms in patients and for using a clinical pharmacogenomic approach to IVIG therapy. To the Editor: Human intravenous immunoglobulin (IVIG) administered at a high dose suppresses inflammation caused by several autoimmune diseases. Although IVIG is licensed for the treatment of patients with Kawasaki disease (KD), idiopathic thrombocytic purpura, Guillan-Barré syndrome, and chronic inflammatory demyelinating polyneuropathy, the modes of action in these clinical syndromes require elucidation. Proposed mechanisms include F(ab′)2-dependent modulation of pathogenic autoantibody neutralization, cytokine production, and complement component neutralization.1Negi V.S. Elluru S. Siberil S. Graff-Dubois S. Mouthon L. Kazatchkine M.D. et al.Intravenous immunoglobulin: an update on the clinical use and mechanisms of action.J Clin Immunol. 2007; 27: 233-245Crossref PubMed Scopus (204) Google Scholar However, studies with clinical and murine models show that IVIG anti-inflammatory potency depends more on the IgG Fc binding to receptors expressed on the surface of various immune cells. The Fcγ receptor (FcγR) family contains multiple activating receptors and a single inhibitory receptor, FcγRIIB. Importantly, B cells express only the inhibitory type. Presumably, IVIG modulates the balance between activating and inhibitory receptors. FcγRIIB plays a central role in mediating Fc-dependent anti-inflammatory actions in mice.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar IVIG elicits a minimal therapeutic effect in FcγRIIB-deficient mice with autoimmune disease3Samuelsson A. Towers T.L. Ravetch J.V. Anti-inflammatory activity of IVIG mediated through the inhibitory Fc receptor.Science. 2001; 291: 484-486Crossref PubMed Scopus (880) Google Scholar but induces FcγRIIB surface expression on splenic macrophages in wild-type mice,4Kaneko Y. Nimmerjahn F. Madaio M.P. Ravetch J.V. Pathology and protection in nephrotoxic nephritis is determined by selective engagement of specific Fc receptors.J Exp Med. 2006; 203: 789-797Crossref PubMed Scopus (206) Google Scholar thereby preventing antibody-induced inflammation. Also, IVIG upregulates FcγRIIB expression by monocytes and B cells among clinically responding patients with chronic inflammatory demyelinating polyneuropathy.5Tackenberg B. Jelcic I. Baerenwaldt A. Oertel W.H. Sommer N. Nimmerjahn F. et al.Impaired inhibitory Fcgamma receptor IIB expression on B cells in chronic inflammatory demyelinating polyneuropathy.Proc Natl Acad Sci U S A. 2009; 106: 4788-4792Crossref PubMed Scopus (193) Google Scholar Although these studies in mice and the limited patient data support a model for FcγRIIB involvement in IVIG actions, further clinical confirmation is required. We thus tested our hypothesis that the gene encoding FcγRIIB participates in IVIG anti-inflammatory action in human subjects by determining whether functionally relevant polymorphisms for this gene influence IVIG response in a KD cohort. This autoimmune syndrome produces acute and diffuse vasculitis. There is predilection for the coronary arteries, in which aneurysms occur in 20% to 25% of untreated patients. IVIG (2 g/kg) with aspirin represents the only standard therapy recommended for acute KD, but the response is variable. The American Heart Association and American Academy of Pediatrics define failure to respond or IVIG refractoriness to treatment as persistent or recurrent fever (temperature >38°C) at greater than 36 hours after completing the initial IVIG infusion.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar The IVIG refractory rate, depending on the clinical series, is reported to be between 13% to 30%.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar Coronary artery vasculitis and aneurysms occur at comparatively high rates in refractory patients.7Tremoulet A.H. Best B.M. Song S. Wang S. Corinaldesi E. Eichenfield J.R. et al.Resistance to intravenous immunoglobulin in children with Kawasaki disease.J Pediatr. 2008; 153: 117-121Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar With institutional review board approval and parental consent, we obtained DNA from patients with KD (n = 383) and parents (n = 578) from 3 centers in the Pacific Northwest. Qualifying patients met strict American Heart Association/American Academy of Pediatrics clinical criteria for the diagnosis of KD.6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar The predominantly male cohort (59%) showed median KD age of onset at 34.5 months (interquartile range, 15-61.5 months). In our IVIG response analysis, we only included the patients with KD (231 responders, 76 refractory) if they received standard treatment within 10 days, followed guidelines prescribing IVIG refractoriness,6Newburger J.W. Takahashi M. Gerber M.A. Gewitz M.H. Tani L.Y. Burns J.C. et al.Diagnosis, treatment, and long-term management of Kawasaki disease: a statement for health professionals from the Committee on Rheumatic Fever, Endocarditis, and Kawasaki Disease, Council on Cardiovascular Disease in the Young, American Heart Association.Pediatrics. 2004; 114: 1708-1733Crossref PubMed Scopus (1089) Google Scholar and were not participating in other treatment-related clinical trials. In all patients with KD and their parents (for frequency comparisons), we pyrosequenced (see the Methods section in this article’s Online Repository at www.jacionline.org) the DNA regions containing 3 known functional polymorphisms in the FCGR2B gene: a single nucleotide polymorphism in the FCGR2B region encoding either isoleucine (I) or threonine (T) amino acid at position 232 within the transmembrane region (nucleotide position +775; IIB+775 [T/c]), which is known to alter the function of this receptor, and 2 single nucleotide polymorphisms at positions −386 (IIB-386 [G/c]) and −120 (IIB-120 [T/a]) upstream from the translation start site known to alter the promoter activity, resulting in differing levels of receptor expression.8Li S. Ptacek T.S. Brown E.E. Edberg J.C. FcG receptors: structure, function and role as genetic risk factors in SLE.Genes Immun. 2009; 10: 380-389Crossref PubMed Scopus (98) Google Scholar We assigned race to subjects from this heterogeneous US population using 155 ancestry informative markers (AIMs) specific for Asian, African, Native American, and European descent (see the Methods section in this article’s Online Repository for more information). However, the allele frequency for all 3 polymorphisms differed substantially among the major racial and ethnic groups. Most strikingly, the A allele at FCGR2B-120T/a was totally absent in Asian patients (n = 48) and their unaffected parents (n = 86) and African American patients (n = 10) and their parents (n = 16); it was rare in Hispanic patients (n = 40) and their parents (n = 67). Thus we analyzed the effect of the polymorphisms on IVIG treatment response for each race, including the heterogeneous Hispanic population, separately. In Caucasian subjects the minor allele A at FCGR2B−120T/a occurred more frequently among the responders (15%) than the nonresponders (5%), with an odds ratio of 3.23 (95% CI, 1.22-8.33; P = .01; Table I). The overall genotypic distribution was different in responders and nonresponders (P = .03). Furthermore, no IVIG nonresponders were AA homozygous, whereas 5 (4%) of 128 responders were homozygotes, and a similar trend was observed with heterozygotes, occurring more frequently (23% vs 11%) among the responders (Fig 1). The Armitage trend test suggested a higher likelihood of being a responder with increased numbers of A alleles (P = .02). Only 2 Hispanic patients with KD were heterozygotes (AT); both were also IVIG responders. Consistent with a previous report on FCGR2B-386 (G/c) and FCGR2B-120 (T/a) haplotypes,9Su K. Li X. Edberg J.C. Wu J. Ferguson P. Kimberly R.P. A promoter haplotype of the immunoreceptor tyrosine-based inhibitory motif-bearing FcgammaRIIb alters receptor expression and associates with autoimmunity. II. Differential binding of GATA4 and Yin-Yang1 transcription factors and correlated receptor expression and function.J Immunol. 2004; 172: 7192-7199Crossref PubMed Scopus (93) Google Scholar the frequencies of G-T, C-A, and C-T haplotypes in Caucasian unaffected parents were 91%, 8%, and 1%, respectively. Among the patients, the distributions of these haplotypes differed significantly when comparing responders with nonresponders (84.5% vs 92%, 15% vs 6%, and 0.5% vs 2%, respectively; overall P = .02), with the increased C-A haplotype in the responders tagging FCGR2B-120A. In Asian subjects FCGR2B+775T/c, encoding the transmembrane region, showed trends related to IVIG treatment response, but the power was limited by the small sample size. Boldfaced values are statistically significant. OR, Odds ratio. FcγRIIB inhibits immune response through coligation with either activating FcγRs or with B-cell receptors bound to immune complexes.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar This coligation leads to phosphorylation of the cytoplasmic immunoreceptor tyrosine-based inhibitory motif within the transmembrane FcγRIIB portion. Immunoreceptor tyrosine-based inhibitory motif phosphorylation leads to downstream target dephosphorylation and inhibition of the activating signaling cascade. Inhibition increases with increased FcγRIIB surface expression, which is controlled in part at the transcriptional level. Transfection of the FCGR2B−386/C and FCGR2B−120/A promoter haplotype into BJAB or U397 cells increases constitutive and cyclic AMP–stimulated FCGR2B promoter activity through enhanced binding to GATA4 and Yin-Yang1 (YY1) transcription factors.9Su K. Li X. Edberg J.C. Wu J. Ferguson P. Kimberly R.P. A promoter haplotype of the immunoreceptor tyrosine-based inhibitory motif-bearing FcgammaRIIb alters receptor expression and associates with autoimmunity. II. Differential binding of GATA4 and Yin-Yang1 transcription factors and correlated receptor expression and function.J Immunol. 2004; 172: 7192-7199Crossref PubMed Scopus (93) Google Scholar Accordingly, our data, which were obtained in human subjects and linking increased FCGR2B promoter activity with improved clinical response, confirm the importance of FcγRIIB in mediating the anti-inflammatory action of high-dose IVIG. The prevailing models derived primarily from murine experiments suggest that IVIG sensing occurs through 1 or multiple candidates, such as FcγRIII or DC-SIGN-related-1.2Smith K.G. Clatworthy M.R. FcgammaRIIB in autoimmunity and infection: evolutionary and therapeutic implications.Nat Rev Immunol. 2010; 10: 328-343Crossref PubMed Scopus (365) Google Scholar FcγRIIB is downstream within a signaling cascade but is required to trigger IVIG-mediated inflammatory inhibition. Thus functional polymorphisms or other influences in 1 or multiple candidate genes along this cascade could also affect the IVIG response. The specificity of this promoter polymorphism for the Caucasian population suggests that these candidates or others, possibly involving the activating FcγRs, could be responsible for the IVIG response variation in subjects of other races. This study provides the basis for defining the IVIG regulatory mechanisms in patients and for using a clinical pharmacogenomic approach to IVIG therapy. We thank the participating patients and their parents. We also thank the investigators, pediatricians, and staffs of the participating clinics. We thank Norman Buroker for handling of the biospecimens and for DNA extraction and Aditi Shendre and Deborah S. McDuffie for genotyping. MethodsGenotypingThree functional polymorphisms in the FCGR2B gene family were genotyped by using pyrosequencing methodology with a PCR reaction with the Failsafe PCR system (Epicenter Technologies, Madison, Wis). The PCR reactions and cycling conditions have been previously described.E1Edberg J.C. Langefeld C.D. Wu J. Moser K.L. Kaufman K.M. Kelly J. et al.Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus.Arthritis Rheum. 2002; 46: 2132-2140Crossref PubMed Scopus (131) Google Scholar Briefly, initial long-range PCR amplifications were performed with the following primers to ensure gene-specific amplification: FCGR2B+775 (T/c) forward CTAAGAGGAGCCCTTCCCTAT and reverse AATACGGGCCTAGATCTGAATG; FCGR2B−386 (G/c) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA; and FCGR2B−120 (T/a) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA. A second nested PCR reaction (using 0.25 μL of the first PCR) was performed around the single nucleotide polymorphism site by using a biotinylated primer to allow for purification of a single-stranded template for the pyrosequencing reaction as follows: FCGR2B+775 (T/c) forward TCCCTAACTCCCAGCTCTTCAC and reverse bio-CTACAAAACCTGAAATCCGCTTTTT; FCGR2B−386 (G/c) forward TCAAGAAGCATCCAGATTCCAG and reverse bio-AAACTCAGCTCAGAACCTCCTGTT; and FCGR2B−120 (T/a) forward AAAGAGGGTGGAAAGGGAGGAG and reverse bio-CTCTCAAAGCTTGGCGGATTCTAC. After denaturation of the PCR amplicon in 0.1 mol/L NaOH for 10 minutes, the single-strand product is immobilized to streptavidin-sepharose (Amersham Biosciences, Piscataway, NJ), washed, and annealed with 15 pmol of the following “pyrosequencing” primer: FCGR2B+775 (T/c), TGGCTGTGGTCACTGGGA; FCGR2B−386 (G/c), TGCTGGTGCACGCTGTCCT; and FCGR2B−120 (T/a), CCTGTGATAAAACAGAACAT. Pyrosequencing was performed according to the manufacturer’s instructions, as previously described.E2Edberg J.C. Wu J. Langefeld C.D. Brown E.E. Marion M.C. McGwin Jr., G. et al.Genetic variation in the CRP promoter: association with systemic lupus erythematosus.Hum Mol Genet. 2008; 17: 1147-1155Crossref PubMed Scopus (55) Google ScholarAIMsThis study is based on the potentially admixed population in the northwestern United States. One hundred fifty-five genome-wide ancestry informative markers specific for Asians, Africans, Native Americans, and Europeans were typed in the BeadExpress assay in the Illumina platform (Illumina, Inc, San Diego, Calif) to account for population stratification.Statistical methodsGenotypes for the AIMs that successfully passed the Illumina QC test were used to calculate principal components of ancestry through use of the principle components analysis (PCA) program from the Eigenstrat software package.E3Price A.L. Patterson N.J. Plenge R.M. Weinblatt M.E. Shadick N.A. Reich D. Principal components analysis corrects for stratification in genome-wide association studies.Nat Genet. 2006; 38: 904-909Crossref PubMed Scopus (6703) Google Scholar On the basis of the eigenvalues determined in this analysis, the first 3 components were chosen to be used for classification of the subjects into distinct genetic ethnicities. The values calculated by means of PCA were subjected to a discriminant analysisE4Rao C.R. Linear statistical inference. John Wiley & Sons, New York1973Google Scholar by using the Discrim procedure in SAS version 9.2 (SAS Institute, Inc, Cary, NC). The subjects chosen were those who identified themselves as members of only 1 of the following ethnic groups for a formal classification analysis: Caucasian, Asian, or Hispanic. Because of small numbers, other groups were excluded. This procedure determined that a quadratic discriminant function was more appropriate than a linear function. The discriminant function calculated from subjects in these 3 self-identified groups was applied to the remainder of the subjects who had results from the PCA analysis. These included self-identified African Americans, Native Americans, those who self-identified to be in multiple groups, and those who did not provide any self-identification. The final results of this objective analysis were viewed subjectively, and subjects not clearly within a cluster were reclassified as “other mixed.”A case-control approach was performed to examine the differential distribution of alleles and genotypes for each of the 3 variants among participants who did not respond to IVIG treatments (cases) versus those who responded (control subjects). Additionally, distributions of haplotypes based on the 2 variants in the promoter region were examined between cases and control subjects. All analyses were performed for the entire set of patients with KD and also separately for Caucasians, Asians, and Hispanics, as determined by PCA of AIMs. ORs with 95% CIs and P values were calculated for all analytic comparisons. GenotypingThree functional polymorphisms in the FCGR2B gene family were genotyped by using pyrosequencing methodology with a PCR reaction with the Failsafe PCR system (Epicenter Technologies, Madison, Wis). The PCR reactions and cycling conditions have been previously described.E1Edberg J.C. Langefeld C.D. Wu J. Moser K.L. Kaufman K.M. Kelly J. et al.Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus.Arthritis Rheum. 2002; 46: 2132-2140Crossref PubMed Scopus (131) Google Scholar Briefly, initial long-range PCR amplifications were performed with the following primers to ensure gene-specific amplification: FCGR2B+775 (T/c) forward CTAAGAGGAGCCCTTCCCTAT and reverse AATACGGGCCTAGATCTGAATG; FCGR2B−386 (G/c) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA; and FCGR2B−120 (T/a) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA. A second nested PCR reaction (using 0.25 μL of the first PCR) was performed around the single nucleotide polymorphism site by using a biotinylated primer to allow for purification of a single-stranded template for the pyrosequencing reaction as follows: FCGR2B+775 (T/c) forward TCCCTAACTCCCAGCTCTTCAC and reverse bio-CTACAAAACCTGAAATCCGCTTTTT; FCGR2B−386 (G/c) forward TCAAGAAGCATCCAGATTCCAG and reverse bio-AAACTCAGCTCAGAACCTCCTGTT; and FCGR2B−120 (T/a) forward AAAGAGGGTGGAAAGGGAGGAG and reverse bio-CTCTCAAAGCTTGGCGGATTCTAC. After denaturation of the PCR amplicon in 0.1 mol/L NaOH for 10 minutes, the single-strand product is immobilized to streptavidin-sepharose (Amersham Biosciences, Piscataway, NJ), washed, and annealed with 15 pmol of the following “pyrosequencing” primer: FCGR2B+775 (T/c), TGGCTGTGGTCACTGGGA; FCGR2B−386 (G/c), TGCTGGTGCACGCTGTCCT; and FCGR2B−120 (T/a), CCTGTGATAAAACAGAACAT. Pyrosequencing was performed according to the manufacturer’s instructions, as previously described.E2Edberg J.C. Wu J. Langefeld C.D. Brown E.E. Marion M.C. McGwin Jr., G. et al.Genetic variation in the CRP promoter: association with systemic lupus erythematosus.Hum Mol Genet. 2008; 17: 1147-1155Crossref PubMed Scopus (55) Google Scholar Three functional polymorphisms in the FCGR2B gene family were genotyped by using pyrosequencing methodology with a PCR reaction with the Failsafe PCR system (Epicenter Technologies, Madison, Wis). The PCR reactions and cycling conditions have been previously described.E1Edberg J.C. Langefeld C.D. Wu J. Moser K.L. Kaufman K.M. Kelly J. et al.Genetic linkage and association of Fcgamma receptor IIIA (CD16A) on chromosome 1q23 with human systemic lupus erythematosus.Arthritis Rheum. 2002; 46: 2132-2140Crossref PubMed Scopus (131) Google Scholar Briefly, initial long-range PCR amplifications were performed with the following primers to ensure gene-specific amplification: FCGR2B+775 (T/c) forward CTAAGAGGAGCCCTTCCCTAT and reverse AATACGGGCCTAGATCTGAATG; FCGR2B−386 (G/c) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA; and FCGR2B−120 (T/a) forward CTCCACAGGTTACTCGTTTCTACCTTATCTTAC and reverse GCTTGCGTGGCCCCTGGTTCTCA. A second nested PCR reaction (using 0.25 μL of the first PCR) was performed around the single nucleotide polymorphism site by using a biotinylated primer to allow for purification of a single-stranded template for the pyrosequencing reaction as follows: FCGR2B+775 (T/c) forward TCCCTAACTCCCAGCTCTTCAC and reverse bio-CTACAAAACCTGAAATCCGCTTTTT; FCGR2B−386 (G/c) forward TCAAGAAGCATCCAGATTCCAG and reverse bio-AAACTCAGCTCAGAACCTCCTGTT; and FCGR2B−120 (T/a) forward AAAGAGGGTGGAAAGGGAGGAG and reverse bio-CTCTCAAAGCTTGGCGGATTCTAC. After denaturation of the PCR amplicon in 0.1 mol/L NaOH for 10 minutes, the single-strand product is immobilized to streptavidin-sepharose (Amersham Biosciences, Piscataway, NJ), washed, and annealed with 15 pmol of the following “pyrosequencing” primer: FCGR2B+775 (T/c), TGGCTGTGGTCACTGGGA; FCGR2B−386 (G/c), TGCTGGTGCACGCTGTCCT; and FCGR2B−120 (T/a), CCTGTGATAAAACAGAACAT. Pyrosequencing was performed according to the manufacturer’s instructions, as previously described.E2Edberg J.C. Wu J. Langefeld C.D. Brown E.E. Marion M.C. McGwin Jr., G. et al.Genetic variation in the CRP promoter: association with systemic lupus erythematosus.Hum Mol Genet. 2008; 17: 1147-1155Crossref PubMed Scopus (55) Google Scholar AIMsThis study is based on the potentially admixed population in the northwestern United States. One hundred fifty-five genome-wide ancestry informative markers specific for Asians, Africans, Native Americans, and Europeans were typed in the BeadExpress assay in the Illumina platform (Illumina, Inc, San Diego, Calif) to account for population stratification. This study is based on the potentially admixed population in the northwestern United States. One hundred fifty-five genome-wide ancestry informative markers specific for Asians, Africans, Native Americans, and Europeans were typed in the BeadExpress assay in the Illumina platform (Illumina, Inc, San Diego, Calif) to account for population stratification. Statistical methodsGenotypes for the AIMs that successfully passed the Illumina QC test were used to calculate principal components of ancestry through use of the principle components analysis (PCA) program from the Eigenstrat software package.E3Price A.L. Patterson N.J. Plenge R.M. Weinblatt M.E. Shadick N.A. Reich D. Principal components analysis corrects for stratification in genome-wide association studies.Nat Genet. 2006; 38: 904-909Crossref PubMed Scopus (6703) Google Scholar On the basis of the eigenvalues determined in this analysis, the first 3 components were chosen to be used for classification of the subjects into distinct genetic ethnicities. The values calculated by means of PCA were subjected to a discriminant analysisE4Rao C.R. Linear statistical inference. John Wiley & Sons, New York1973Google Scholar by using the Discrim procedure in SAS version 9.2 (SAS Institute, Inc, Cary, NC). The subjects chosen were those who identified themselves as members of only 1 of the following ethnic groups for a formal classification analysis: Caucasian, Asian, or Hispanic. Because of small numbers, other groups were excluded. This procedure determined that a quadratic discriminant function was more appropriate than a linear function. The discriminant function calculated from subjects in these 3 self-identified groups was applied to the remainder of the subjects who had results from the PCA analysis. These included self-identified African Americans, Native Americans, those who self-identified to be in multiple groups, and those who did not provide any self-identification. The final results of this objective analysis were viewed subjectively, and subjects not clearly within a cluster were reclassified as “other mixed.”A case-control approach was performed to examine the differential distribution of alleles and genotypes for each of the 3 variants among participants who did not respond to IVIG treatments (cases) versus those who responded (control subjects). Additionally, distributions of haplotypes based on the 2 variants in the promoter region were examined between cases and control subjects. All analyses were performed for the entire set of patients with KD and also separately for Caucasians, Asians, and Hispanics, as determined by PCA of AIMs. ORs with 95% CIs and P values were calculated for all analytic comparisons. Genotypes for the AIMs that successfully passed the Illumina QC test were used to calculate principal components of ancestry through use of the principle components analysis (PCA) program from the Eigenstrat software package.E3Price A.L. Patterson N.J. Plenge R.M. Weinblatt M.E. Shadick N.A. Reich D. Principal components analysis corrects for stratification in genome-wide association studies.Nat Genet. 2006; 38: 904-909Crossref PubMed Scopus (6703) Google Scholar On the basis of the eigenvalues determined in this analysis, the first 3 components were chosen to be used for classification of the subjects into distinct genetic ethnicities. The values calculated by means of PCA were subjected to a discriminant analysisE4Rao C.R. Linear statistical inference. John Wiley & Sons, New York1973Google Scholar by using the Discrim procedure in SAS version 9.2 (SAS Institute, Inc, Cary, NC). The subjects chosen were those who identified themselves as members of only 1 of the following ethnic groups for a formal classification analysis: Caucasian, Asian, or Hispanic. Because of small numbers, other groups were excluded. This procedure determined that a quadratic discriminant function was more appropriate than a linear function. The discriminant function calculated from subjects in these 3 self-identified groups was applied to the remainder of the subjects who had results from the PCA analysis. These included self-identified African Americans, Native Americans, those who self-identified to be in multiple groups, and those who did not provide any self-identification. The final results of this objective analysis were viewed subjectively, and subjects not clearly within a cluster were reclassified as “other mixed.” A case-control approach was performed to examine the differential distribution of alleles and genotypes for each of the 3 variants among participants who did not respond to IVIG treatments (cases) versus those who responded (control subjects). Additionally, distributions of haplotypes based on the 2 variants in the promoter region were examined between cases and control subjects. All analyses were performed for the entire set of patients with KD and also separately for Caucasians, Asians, and Hispanics, as determined by PCA of AIMs. ORs with 95% CIs and P values were calculated for all analytic comparisons.