Abstract
The final steps in assembly of the lytic pore formed by staphylococcal alpha-hemolysin (alpha HL) involve the formation of a nonlytic oligomeric pore precursor, followed by the formation of a transmembrane channel. In this study, truncation mutants of alpha HL encompassing the NH2-terminal or COOH-terminal half of the polypeptide chain and all, part, or none of the central glycine-rich loop were obtained by in vitro, coupled transcription and translation of mutant plasmid DNAs. These polypeptides were unable to oligomerize upon or cause lysis of rabbit erythrocytes (rRBCs). Twenty-one pairs of the same truncation mutants constituting discontinuous alpha HL chains with overlaps, nicks, and gaps in the central loop were obtained by cotranslation. When incubated with rRBCs, many of the pairs were able to form hetero-oligomers with wild-type alpha-hemolysin (s-alpha HL) and most of these formed homo-oligomers in the absence of s-alpha HL. However, only members of a subset of these pairs were able to lyse the cells. The lytic combinations contained overlaps, nicks, or gaps, but only two pairs, with nicks between amino acid residues 128 and 129 and between 131 and 132 had hemolytic activities approaching that of the wild-type polypeptide. Active combinations could also be obtained by separately translating NH2- and COOH-terminal truncation mutants and then combining them. These findings suggest that the integrity of the central loop is of little significance for oligomer formation but that it is more important for the final step in pore assembly or alternatively for determining the correct structure of the conductive channel. Our findings disagree with previous reports of NH2- and COOH-terminal fragments with hemolytic activity and of the prevention of hemolysis by proteolytic cleavage in the central loop. This discord is attributed to experimental and interpretative ambiguities in the earlier protein chemistry. For example, we show that loss of hemolytic activity after treatment with trypsin is not due to cleavage after Lys-131, as previously proposed, but to the removal of a small NH2-terminal peptide through cleavage after Lys-8.
Highlights
The final stepsin assembly of the lytic pore formed gating the assembly of an oligomeric membrane pore [1].The by staphylococcal a-hemolysin involve the for- aHL polypeptide of 33,200 daltons (293 amino acids) is semation of a nonlytic oligomeric pore precursor, fol- creted by Staphylococcus aureus as awater-soluble monomer, lowed by the formation of a transmembrane channel. which assembles into cylindrical pores in susceptible cell
In certain SDS-stable Oligomers in the Absence of rabbit red blood cells (rRBCs)-Individual cases the codon following the initiator was for alanine, rather than 35S-labeledaHL polypeptides truncated at the NH2 terminus the naturally occurring amino acid, to ensure efficient cotranslational removal of the NHz-terminal methionine [26, 27] and tolimit proteolytic degradation [28]
The mutantpolypeptides derived from these primers are designated by the prefix “A.” In the cases of aHL(129293) and aHL1(43-293), the codons followingthe initiator are for the naturally occurring Thr andGly residues, respectively, and processing (AN: aHL(A119-293), aHL[129-293], aHL[143-293], aHL(A160-293), and aHL(A175-293)) andatthe COOH terminus (AC: aHL[1-172],aHL[1-142],aHL[1-128], and aHL[1-118]) were produced by in vitrtoranscription and translation (IVTT) andsubjected to SDSpolyacrylamide gel electrophoresis
Summary
SDS-containing loading buffer [25]I.nstead, they were warmed at 45 “C for 5 min, conditions underwhich noncovalent hexamers of s-aHL or r-aHLare stable.SDS-stable hexamers or other oligomeric forms were not detected in any CGGGATCCTAATACGACTCACTATAGGG, which hybridizes to of the truncation mutant preparations (Fig. IA), even after the T7 promoter region upstream from the NdeI site encompassing autoradiographic overexposure of the dried gels. The amplification products were cut with NdeI and HindIII and inserted downstream from the T7 promoter in the vector pT7SflA [26], aderivative of pT7flA [30].To obviate possible problems with polymerase chain reaction errors the NH2- and COOH-terminal Halves of the aHL Polypeptide Neither Lyse rRBCs nor Oligomerize in Their PresenceIndividually translated AN and AC truncation mutantsexhibited no hemolytic activity whatsoever in an assay that would number of cycles was minimized (usually ten) and each experiment have readily detected apolypeptide with one one-hundreth of Complementation of a-Hemolysin Fragments
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
