Abstract
N-Methyl-d-aspartate (NMDA) receptor subunit 2A (NR2A) is an important modulatory component of the NMDA subtype of glutamate receptors. To investigate the transcription mechanism of the NR2A gene, we cloned the 5'-flanking sequence from a rat genomic library. RNA mapping with rat brain RNA revealed two sets of major and several minor transcription start points in a single exon of 1140 bp. Reporter gene and mutation studies indicated that core promoter activity resided in exon 1, whereas the 5'-flanking sequence up to 1.5 kb showed no significant impact on promoter activity. Fragments containing minor transcription start points were able to drive a reporter gene in transfected cells and produce nascent RNAs in an in vitro transcription system. All fragments tested showed more promoter activity in dissociated neurons of the rat embryonic cerebrocortex and cell lines expressing NR2A mRNA than that in glial cultures and non-neuronal cells. Within exon 1 there are three GC-box elements that displayed distinct binding affinity to both Sp1- and Sp4-like factors. Overexpression of Sp1 or Sp4, but not Sp3, significantly increased the activity of the promoter containing these elements. Inclusion of exon 2 and 3 sequences, which contain five short open-reading frames, attenuated promoter-driven reporter activity more than 3-fold but attenuated the level of reporter mRNA less than 1.4-fold. Our results suggest that the core promoter of the rat NR2A gene requires exon 1, that Sp factors positively regulate this core promoter, and that a post-transcriptional mechanism may negatively regulate expression of the gene.
Highlights
N-Methyl-D-aspartate (NMDA) receptor subunit 2A nal differentiation, as well as in the excitotoxicity of glutamate (NR2A) is an important modulatory component of the on neurons [1, 2]
Exon 1 alone retains promoter activity preferential in neurons or neuronal cells, whereas the 5Ј-flanking sequences of the NR2A gene up to 1.5 kb have no significant impact on the promoter activity
Further studies of deletion fragments with reporter gene and in vitro transcription experiments demonstrated that the core promoter resides in the exon 1 of the rat NR1 gene and the full promoter activity depends upon the major transcription start points (TSPs) for cell-type preference
Summary
Materials—A rat genomic library harboring EcoRI partially digested DNA (Sprague-Dawley) in the lambda phage was purchased from Clontech (Palo Alto, CA). The resulting PCR product was treated with Klenow enzyme, cloned into pGEM3Zf(ϩ) at the HincII site (Promega, Madison, WI), and sequenced as described previously [34]. Rat brain poly(A)ϩ RNA was purchased from Clontech or prepared as described previously [35]. Reverse Transcription-PCR—Total RNA was extracted from rat and mouse brains as described above and from cultured cells with TRIzol (Invitrogen) following the manufacturer’s instructions. Three l of the reaction of cell lines, 2 l of cultured neurons, or 1 l of brain tissues was used in a PCR to detect NR2A mRNA with human primers, GB509 (5Ј-TGATGAGGGAACCTCTTTGG)/GB510 (5Ј-GGTTGCTCTTCTCCATCAGC), rat primers, GB508 (5Ј-TGTGAAGAAATGCTGCAAGG)/GB511 (5Ј-GAACGCTCCTCATTGATGGT), or mouse primers, GB512 (5ЈCCATCAGCAGGGGCATCTACAG)/GB513 (5Ј-ACTGTGTTGGGGTTGGACTCAT). DNA-Protein Interaction Analysis—Crude nuclear extractions were prepared from cells as previously described [37]. Results of EMSA were analyzed and quantified with a PhosphorImager as described in our previous studies [41]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
