First Report of Tomato Mottle Mosaic Virus in Tomato Crops in China.

Abstract

Tomato (Solanum lycopersicum L.), an economically important vegetable crop, is widely cultivated in China. Tomato can be infected with viruses in single or mixed infections, producing severe symptoms that result in significant yield reduction. To identify viruses infecting tomato, a provincial-wide virus survey was carried out in seven open-field tomato-producing areas of Hainan province during November 2016 to February 2017. A total of 170 tomato leaf samples showing foliar mottle, stunting, leaf distortion, and necrosis symptoms were collected. Eight randomly selected leaf samples were combined into one sample, and total RNA was extracted from the pooled sample with TRIzol Reagent (Invitrogen, Carlsbad, CA). A small RNA library was prepared with TruSeq Small RNA Library Preparation Kits (Illumina, San Diego, CA) and sequenced on an Illumina HiSeq 4000 sequencer. De novo assembly of the single-end reads was performed using Velvet assembler. The contigs were analyzed using NCBI’s BLAST program (https://www.ncbi.nlm.nih.gov/blast) against the viral RefSeq database. The whole next-generation sequencing procedure was performed by Biomarker Technologies Corporation (Beijing, China). The analysis generated 28,783,437 raw reads, apart from 15.09% of raw reads mapping to tomato mottle mosaic virus (ToMMV), there were sequence reads mapping to tomato yellow leaf curl virus, tobacco mosaic virus, southern tomato virus, cucumber mosaic virus, and tomato mosaic virus. To further confirm the presence of ToMMV in the eight leaf samples, reverse transcription polymerase chain reaction (RT-PCR) was performed using primer pair ToMMV-4491 (TAAAGGGGCGTTTTGTGGTG) and ToMMV-6309 (GCGTTCCAAGACAAAACCCT) designed based on eight available ToMMV full genomic sequences (GenBank accession nos. KU594507, KX898033, KR824951, KR824950, KT810183, KP202857, KF477193, and KX898034). The expected ≈1,820-bp PCR fragments (partial sequence of RNA dependent RNA polymerase, complete sequence of the movement protein and coat protein coding region of ToMMV) were amplified from three randomly selected symptomatic tomato samples. These fragments were cloned into the pMD18-T Vector (TaKaRa, Dalian, China) and sequenced (Beijing Genomics Institute, Shenzhen, China). BLASTn searches of the clones (GenBank accession nos. MG920804, MG920805, and MG920806) revealed that all sequences had 99.3 to 99.8% identity with currently available ToMMV full genomic sequences. To study the presence of ToMMV in the samples, RT-PCR assays using specific primers (ToMMV-4491/ToMMV-6309) were performed. Thirty-one out of the 170 samples tested were positive for ToMMV, suggesting that the virus was widespread in the field. ToMMV, a species in the genus Tobamovirus, was first reported from a tomato sample collected in Mexico in 2013 (Li et al. 2013). In just a few years, ToMMV has been reported to infect tomato and pepper in several countries. ToMMV also could infect plants in the Brassicaceae by sap transmission (Li et al. 2017). Previously, ToMMV was only found to infect the pepper grown in the field in China (Li et al. 2014). Our results confirmed the infection of tomato by ToMMV in Hainan, China. To the best of our knowledge, this is the first report of ToMMV naturally infecting tomato in China, thus providing further characterization of ToMMV and highlighting its potential as a worldwide threat to solanaceous vegetable crop production. Attention should be paid to this emerging viral disease, and measures should be taken to control the spread of ToMMV.